prmt5 knockdown cells Search Results


99
ATCC crl 1573 hct116 prmt5 ko
Figure 1. <t>PRMT5</t> knockout enhances TDP1 protein levels (A) Immunoprecipitation of ectopic FLAG-TDP1 using anti-FLAG antibody from wild-type and PRMT5 KO cells. The immune complexes were blotted with SDMA- specific antibodies and then stripped and re-probed with an anti-FLAG antibody to show equal loading. (B and C) Induction of TDP1 expression in PRMT5 KO cells. A representative blot showing TDP1 and PRMT5 protein levels after treatment with CPT (5 mM) for the indicated times (h) from three independent experiments. Proteins were analyzed by western blotting (B) and quantified by densitometry normalized against actin (C). Error bars represent mean ± SEM (n = 3). (D) The wild-type and PRMT5 KO cells were treated with CPT (5 mM) for the indicated times (h), and mRNA levels of TDP1 normalized to actin were analyzed and quantified by real-time PCR. Error bars represent mean ± SEM (n = 3). (E) Alkaline comet assay showing increased induction of DNA strand breaks in PRMT5 KO cells compared with wild-type counterparts following CPT treatment. Comet tails were calculated for 25–30 cells by box-whisker plot using Origin software and show a significant difference (***p < 0.0001; t test). (F) Cell survival curves of PRMT5+/+, PRMT5 KO (PRMT5/), and PRMT5 KO cells complemented with FLAG-tagged wild-type TDP1 (PRMT5/ TDP1 WT), or TDP1 arginine methylation mimic double-mutant R361F and R586F [FF] (PRMT5/ TDP1 FF) were exposed to CPT for 72 h. CPT-induced cytotoxicity (%) was calculated with respect to untreated cells. Error bars represent SD (n = 3). *Statistically significant differences: **p < 0.001; t test.
Crl 1573 Hct116 Prmt5 Ko, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pm35705029-203-153-151?v=ATCC
Average 99 stars, based on 1 article reviews
crl 1573 hct116 prmt5 ko - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

87
Thermo Fisher gene exp prmt5 mm00550472 m1
GLI1 interacts with the <t>MEP50/PRMT5</t> complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.
Gene Exp Prmt5 Mm00550472 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc06338668-283-22--1?v=Thermo+Fisher
Average 87 stars, based on 1 article reviews
gene exp prmt5 mm00550472 m1 - by Bioz Stars, 2026-08
87/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc prmt5
A <t>PRMT5</t> plasmid was transfected into HEK293 and Tu686 cells. After incubated for 48 h, cell lysates were measured by Immunoprecipitation (IP) assays using anti-PRMT5 beads, and the silver staining showed the location of PRMT5 and its associated protein G3BP2. Lane 1,3 for HEK293 cell. Lane 2,4 for Tu686 cell. B , C Co-immunoprecipitation (Co-IP) of PRMT5 and G3BP2 was performed in HEK293 cells. IgG was used as a negative control. D Association of PRMT5 with G3BP2 were verified by Co-IP assay with anti-Flag in Tu212 cells transfected with Flag-PRMT5 or Flag-G3BP2, respectively. E Schematic diagram showed the structure of PRMT5 (left) and the deletion constructs were co-transfected with Flag-G3BP2 into HEK293 cells. Cell lysates were precipitated with GST beads. G3BP2 was blotted with an anti-Flag antibody. Immunoblotting and Coomassie Brilliant blue staining were shown. F The methylation of G3BP2 was detected by western blot analysis using a custom-made methy-G3BP2 antibody in HEK293 and Tu212 cells transfected with or without PRMT5 plasmid. G Methylation site of G3BP2 was examined by liquid chromatography- mass spectrometry (LC-MS). R represents potential methylation site. H Sequences of the evolutionarily conserved residue R468 (red) in G3BP2. I Validation of R468 as the PRMT5-catalyzed G3BP2 methylation site in Tu212 and Tu686 cells. J In vitro methylation of G3BP2 in the presence of 3 H-SAM. Recombinant GST-G3BP2-WT and G3BP2-R468K proteins were purified from bacteria and Flag-PRMT5 proteins were immunopurified from HEK293 cells. K Tu686 cells were treated with the indicated amounts of GSK3326595 for 24 h, protein levels of G3BP2 and methy-G3BP2 were assessed by western blot.
Prmt5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc09988876-91-11-13?v=Cell+Signaling+Technology+Inc
Average 95 stars, based on 1 article reviews
prmt5 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

99
Danaher Inc prmt5
<t>PRMT5</t> potentiates STAT3 activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.
Prmt5, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc08132155-190-8-14?v=Danaher+Inc
Average 99 stars, based on 1 article reviews
prmt5 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
Selleck Chemicals prmt5 inhibitor epz015666 epz
Fig. 1. <t>PRMT5</t> is upregulated during osteoclast differentiation, and PRMT5 knockdown inhibits osteoclast differentiation. (A) BMMs were cultured in the presence of M-CSF (30 ng/mL) and RANKL (100 ng/mL) and were collected at the indicated time points to analyze PRMT5 and c-fos protein expression. (B–C) PRMT5 protein expression in BMMs cells was assessed by western blotting. GAPDH was used as a loading control. Band densities were quantified and normalized to the control. Data are presented as mean ± SD of three independent experiments. *P b 0.05. (D–E) BMMs were seeded in 96-well plates at a density of 1.5 × 104 cells per well, transfected with PRMT5 siRNA and cultured in the presence of RANKL (100 ng/mL) and M-CSF (30 ng/mL) for 5 days. TRAP staining was performed, and TRAP-positive cells with three or more nuclei were counted using a microscope. Data are presented as mean ± SD of three independent experiments. *P b 0.05, **P b 0.01 versus vehicle.
Prmt5 Inhibitor Epz015666 Epz, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pm28302565-50-1-8?v=Selleck+Chemicals
Average 94 stars, based on 1 article reviews
prmt5 inhibitor epz015666 epz - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology prmt5
Summary of <t> PRMT5 </t> scoring distribution
Prmt5, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc04635578-92-24-26?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
prmt5 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc α prmt5
ULK1 interacts directly with the <t>PRMT5</t> complex independent of its role in autophagy. ( A ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by 1 h of starvation treatment with EBSS. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, PRMT5, WD45, and pICln. ( B ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by treatment with full or starvation medium (EBSS) in the absence or presence of bafilomycin A1 (BafA1; 10 nM) for 1 h. Afterward, cells were harvested, lysed, and cleared cellular lysates were subjected to Tris/Glycine-SDS-PAGE and immunoblotting for GFP, ULK1 pS757, ATG14, ATG14 pS29, p62, LC3, GAPDH, and Actin. ( C ) Flp-In T-REx 293-GFP-ULK1, -GFP-ULK1/ΔCTD and -GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against FIP200, GFP, PRMT5, ATG13, WD45, pICln and ATG101. ( D ) HEK293T cells were stably transfected with pMSCVbsd-GFP-ULK1 kinase domain (k. dom.) and pMSCVbsd-GFP constructs. Additionally, HEK293T cells were transiently transfected with pcDNA5-FRT-TO-GFP-ULK1 GABARAP domain (GABARAP dom.) and -ULK1 C-terminal domain (CTD) constructs. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, FIP200, ATG13, ATG101, PRMT5, WD45, and pICln. ( E ) S100 extract was generated of HEK293T cells and applied to a Superdex 200 increase column. Fractions were analyzed by Tris/Glycine-SDS-PAGE and immunoblotting using antibodies against ULK1, ATG13, ATG101, PRMT5, WD45 and pICln. ( F ) S100 extract of HEK293T cells was applied to a Superdex 200 increase column and subsequent immunoprecipitation of endogenous was performed with antibody against ULK1. Immunoprecipitation was analyzed by Tris/Glycine-SDS-PAGE using antibodies against ULK1 and pICln.
α Prmt5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc08216288-18-54-56?v=Cell+Signaling+Technology+Inc
Average 93 stars, based on 1 article reviews
α prmt5 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Proteintech anti prmt5 antibody
Cardiac-specific overexpression of <t>PRMT5</t> accelerates pressure overload-induced cardiac systolic dysfunction. a A schematic diagram of the transgene to create mice with cardiac-specific Prmt5 overexpression (PRMT5-TG). b Images of WT and PRMT5-TG mice littermates at 10 weeks of age. Scale bar: 20 µm. c Cardiac PRMT5 overexpression confirmed using Western blotting. d Echocardiographic analysis images of PRMT5-TG mice performed 4 weeks after TAC surgery. e , f Fractional shorting ( e ) and ejection fraction ( f ) calculated from M-mode echocardiography. Values are presented as mean ± SD (n = 6–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. *** p < 0.001
Anti Prmt5 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pmc12229037-109-31-62?v=Proteintech
Average 93 stars, based on 1 article reviews
anti prmt5 antibody - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Bio X Cell preclinical 151 prmt5 inhibitor gsk591
Cardiac-specific overexpression of <t>PRMT5</t> accelerates pressure overload-induced cardiac systolic dysfunction. a A schematic diagram of the transgene to create mice with cardiac-specific Prmt5 overexpression (PRMT5-TG). b Images of WT and PRMT5-TG mice littermates at 10 weeks of age. Scale bar: 20 µm. c Cardiac PRMT5 overexpression confirmed using Western blotting. d Echocardiographic analysis images of PRMT5-TG mice performed 4 weeks after TAC surgery. e , f Fractional shorting ( e ) and ejection fraction ( f ) calculated from M-mode echocardiography. Values are presented as mean ± SD (n = 6–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. *** p < 0.001
Preclinical 151 Prmt5 Inhibitor Gsk591, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prmt5+knockdown+cells/pm37897562-241-34-53?v=Bio+X+Cell
Average 94 stars, based on 1 article reviews
preclinical 151 prmt5 inhibitor gsk591 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


Figure 1. PRMT5 knockout enhances TDP1 protein levels (A) Immunoprecipitation of ectopic FLAG-TDP1 using anti-FLAG antibody from wild-type and PRMT5 KO cells. The immune complexes were blotted with SDMA- specific antibodies and then stripped and re-probed with an anti-FLAG antibody to show equal loading. (B and C) Induction of TDP1 expression in PRMT5 KO cells. A representative blot showing TDP1 and PRMT5 protein levels after treatment with CPT (5 mM) for the indicated times (h) from three independent experiments. Proteins were analyzed by western blotting (B) and quantified by densitometry normalized against actin (C). Error bars represent mean ± SEM (n = 3). (D) The wild-type and PRMT5 KO cells were treated with CPT (5 mM) for the indicated times (h), and mRNA levels of TDP1 normalized to actin were analyzed and quantified by real-time PCR. Error bars represent mean ± SEM (n = 3). (E) Alkaline comet assay showing increased induction of DNA strand breaks in PRMT5 KO cells compared with wild-type counterparts following CPT treatment. Comet tails were calculated for 25–30 cells by box-whisker plot using Origin software and show a significant difference (***p < 0.0001; t test). (F) Cell survival curves of PRMT5+/+, PRMT5 KO (PRMT5/), and PRMT5 KO cells complemented with FLAG-tagged wild-type TDP1 (PRMT5/ TDP1 WT), or TDP1 arginine methylation mimic double-mutant R361F and R586F [FF] (PRMT5/ TDP1 FF) were exposed to CPT for 72 h. CPT-induced cytotoxicity (%) was calculated with respect to untreated cells. Error bars represent SD (n = 3). *Statistically significant differences: **p < 0.001; t test.

Journal: Cell reports

Article Title: Interplay between symmetric arginine dimethylation and ubiquitylation regulates TDP1 proteostasis for the repair of topoisomerase I-DNA adducts.

doi: 10.1016/j.celrep.2022.110940

Figure Lengend Snippet: Figure 1. PRMT5 knockout enhances TDP1 protein levels (A) Immunoprecipitation of ectopic FLAG-TDP1 using anti-FLAG antibody from wild-type and PRMT5 KO cells. The immune complexes were blotted with SDMA- specific antibodies and then stripped and re-probed with an anti-FLAG antibody to show equal loading. (B and C) Induction of TDP1 expression in PRMT5 KO cells. A representative blot showing TDP1 and PRMT5 protein levels after treatment with CPT (5 mM) for the indicated times (h) from three independent experiments. Proteins were analyzed by western blotting (B) and quantified by densitometry normalized against actin (C). Error bars represent mean ± SEM (n = 3). (D) The wild-type and PRMT5 KO cells were treated with CPT (5 mM) for the indicated times (h), and mRNA levels of TDP1 normalized to actin were analyzed and quantified by real-time PCR. Error bars represent mean ± SEM (n = 3). (E) Alkaline comet assay showing increased induction of DNA strand breaks in PRMT5 KO cells compared with wild-type counterparts following CPT treatment. Comet tails were calculated for 25–30 cells by box-whisker plot using Origin software and show a significant difference (***p < 0.0001; t test). (F) Cell survival curves of PRMT5+/+, PRMT5 KO (PRMT5/), and PRMT5 KO cells complemented with FLAG-tagged wild-type TDP1 (PRMT5/ TDP1 WT), or TDP1 arginine methylation mimic double-mutant R361F and R586F [FF] (PRMT5/ TDP1 FF) were exposed to CPT for 72 h. CPT-induced cytotoxicity (%) was calculated with respect to untreated cells. Error bars represent SD (n = 3). *Statistically significant differences: **p < 0.001; t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor Sigma-Aldrich Cat# 524636 Dithiotheriotol (DTT) Sigma-Aldrich Cat#11583786001 Magnesium Chloride SRL Cat# 69396 Protein A/G beads Santa Cruz Cat# sc-2003 Glycine Himedia Cat# MB013 Paraformaldehyde Sigma-Aldrich Cat# P6148 Potassium Chloride extrapure AR, 99.5% SRL Cat# 1649161 EDTA SRL Cat# 43272 DMSO Amresco Cat# 0231 DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 10569044 Fetal Bovine Serum Gibco (By Life Technologies) Cat# 10270106 Trypsin-EDTA (0.05%) Sigma-Aldrich Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Sigma-Aldrich Cat# 4693159001 Proteinase K Sigma-Aldrich Cat# P2308 Critical commercial assays Reverse transcription kit Applied Biosystems Cat# 4368814 QuikChange II XL site-directed mutagenesis kit Agilent Technologies Cat# 200521 Deposited Data Raw Imaging day This paper; Mandeley data https://doi.org/10.17632/wpnpxn9brh.1 Experimental models: Cell lines TDP1-/- MEFs Dr Cornelius F Boerkoel (Centre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, British Columbia, Canada) N/A HCT116 Developmental Therapeutics Program (NCI, NIH) N/A HEK293 ATCC Cat# CRL-1573 HCT116- PRMT5 KO This Paper N/A Oligonucleotides Prmt5 gRNA CCTGAATTGCGTCCCCGAAATAG This paper N/A UCHL3 siRNA GAUACCUGGAGAACUAUGA Genx M_001270952 Primers for Human TDP1 (Forward: GACGTG GACTGGCTCGTAAA Reverse: GAGCCTTAGCCTCTCTCGCTTATC) This paper N/A Primers for Human Actin (ForwardGACCCAGA TCATGTTTGAGACC Reverse: CATCACGATGCCAGTGGTAC) (Ghosh et al., 2019) N/A Fluorescence based ex vivo assay- ssDNA (HEI40) 56-FAM/AGA GGA TCT AAA AGA CTT/3BHQ (Flett et al., 2018) N/A Fluorescence based ex vivo assay- dsDNA (HEI50) 56-FAM/AAG TCT TTT AGA TCC CTC CGG ATC TAA AAG ACT T/3BHQ (Flett et al., 2018) N/A Fluorescence anisotropy (HEI41-3P) 56-FAM/AGA GGA TCT AAA AGA CTT-3P (Dexheimer et al., 2010) N/A Fluorescence anisotropy (HEI41-3C) 5’ AAGTCTTTTAGATCCTCT 3’ This paper N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene Cat#48138 pCMV-Tag2B-TDP1 WT (FLAGTDP1WT) (Das et al., 2009) N/A (Continued on next page) e2 Cell Reports 39, 110940, June 14, 2022

Techniques: Knock-Out, Immunoprecipitation, Expressing, Western Blot, Real-time Polymerase Chain Reaction, Alkaline Single Cell Gel Electrophoresis, Whisker Assay, Software, Methylation, Mutagenesis

Figure 2. TDP1 is stabilized in PRMT5 KO cells (A–D)The wild-type and PRMT5 KO cells were treated with cycloheximide (CHX) for the indicated time points (h) in the absence (no CPT, A), or presence of CPT (5 mM/3 h; C). The protein levels (TDP1 and PRMT5) were analyzed by western blot- ting (representative blots), and the relative level of TDP1 was quantified by densitometry normalized against actin. The remaining TDP1 level was calcu- lated relative to levels before CHX treatment (B and D). Error bars represent mean ± SEM (n = 3). (E) The increased stability of dimethylation mutant TDP1 is independent of DNA damage. HCT116 cells were transfected with FLAG-tagged wild- type (WT) or the double-mutant R361K and R586K [KK] TDP1 and 24 h later were treated with CHX for the indicated time points (h) in the absence (left), or presence of CPT (5 mM/3 h; right). Representative experiments show ectopic TDP1 levels as determined by western blotting with anti-FLAG antibody. (F) Densitometry analysis of TDP1WT and TDP1KK

Journal: Cell reports

Article Title: Interplay between symmetric arginine dimethylation and ubiquitylation regulates TDP1 proteostasis for the repair of topoisomerase I-DNA adducts.

doi: 10.1016/j.celrep.2022.110940

Figure Lengend Snippet: Figure 2. TDP1 is stabilized in PRMT5 KO cells (A–D)The wild-type and PRMT5 KO cells were treated with cycloheximide (CHX) for the indicated time points (h) in the absence (no CPT, A), or presence of CPT (5 mM/3 h; C). The protein levels (TDP1 and PRMT5) were analyzed by western blot- ting (representative blots), and the relative level of TDP1 was quantified by densitometry normalized against actin. The remaining TDP1 level was calcu- lated relative to levels before CHX treatment (B and D). Error bars represent mean ± SEM (n = 3). (E) The increased stability of dimethylation mutant TDP1 is independent of DNA damage. HCT116 cells were transfected with FLAG-tagged wild- type (WT) or the double-mutant R361K and R586K [KK] TDP1 and 24 h later were treated with CHX for the indicated time points (h) in the absence (left), or presence of CPT (5 mM/3 h; right). Representative experiments show ectopic TDP1 levels as determined by western blotting with anti-FLAG antibody. (F) Densitometry analysis of TDP1WT and TDP1KK

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor Sigma-Aldrich Cat# 524636 Dithiotheriotol (DTT) Sigma-Aldrich Cat#11583786001 Magnesium Chloride SRL Cat# 69396 Protein A/G beads Santa Cruz Cat# sc-2003 Glycine Himedia Cat# MB013 Paraformaldehyde Sigma-Aldrich Cat# P6148 Potassium Chloride extrapure AR, 99.5% SRL Cat# 1649161 EDTA SRL Cat# 43272 DMSO Amresco Cat# 0231 DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 10569044 Fetal Bovine Serum Gibco (By Life Technologies) Cat# 10270106 Trypsin-EDTA (0.05%) Sigma-Aldrich Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Sigma-Aldrich Cat# 4693159001 Proteinase K Sigma-Aldrich Cat# P2308 Critical commercial assays Reverse transcription kit Applied Biosystems Cat# 4368814 QuikChange II XL site-directed mutagenesis kit Agilent Technologies Cat# 200521 Deposited Data Raw Imaging day This paper; Mandeley data https://doi.org/10.17632/wpnpxn9brh.1 Experimental models: Cell lines TDP1-/- MEFs Dr Cornelius F Boerkoel (Centre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, British Columbia, Canada) N/A HCT116 Developmental Therapeutics Program (NCI, NIH) N/A HEK293 ATCC Cat# CRL-1573 HCT116- PRMT5 KO This Paper N/A Oligonucleotides Prmt5 gRNA CCTGAATTGCGTCCCCGAAATAG This paper N/A UCHL3 siRNA GAUACCUGGAGAACUAUGA Genx M_001270952 Primers for Human TDP1 (Forward: GACGTG GACTGGCTCGTAAA Reverse: GAGCCTTAGCCTCTCTCGCTTATC) This paper N/A Primers for Human Actin (ForwardGACCCAGA TCATGTTTGAGACC Reverse: CATCACGATGCCAGTGGTAC) (Ghosh et al., 2019) N/A Fluorescence based ex vivo assay- ssDNA (HEI40) 56-FAM/AGA GGA TCT AAA AGA CTT/3BHQ (Flett et al., 2018) N/A Fluorescence based ex vivo assay- dsDNA (HEI50) 56-FAM/AAG TCT TTT AGA TCC CTC CGG ATC TAA AAG ACT T/3BHQ (Flett et al., 2018) N/A Fluorescence anisotropy (HEI41-3P) 56-FAM/AGA GGA TCT AAA AGA CTT-3P (Dexheimer et al., 2010) N/A Fluorescence anisotropy (HEI41-3C) 5’ AAGTCTTTTAGATCCTCT 3’ This paper N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene Cat#48138 pCMV-Tag2B-TDP1 WT (FLAGTDP1WT) (Das et al., 2009) N/A (Continued on next page) e2 Cell Reports 39, 110940, June 14, 2022

Techniques: Western Blot, Mutagenesis, Transfection

Figure 3. R586 dimethylation promotes ubiquitin-dependent TDP1 proteostasis (A and B) Representative blots showing that TDP1R586K exhibits increased half-life compared with TDP1R361K in the absence of CPT. HCT116 cells were trans- fected with FLAG-TDP1R586K or FLAG-TDP1R361K and later treated with CHX for the indicated time points in the absence (A, top), or in the presence of CPT (5 mM/ 3 h; B, bottom). FLAG-tagged TDP1 levels (A and B, bottom) were determined by western blotting and quantified by densitometry normalized to actin, and the remaining TDP1 level was calculated relative to levels before CHX treatment. Error bars represent mean ± SEM (n = 3). (C) Representative blot showing that proteasomal inhibition with MG132 prevents TDP1 degradation. TDP1/ MEF cells were transfected with FLAG-TDP1 and 24 h later were treated with CHX for the indicated time points (h) in the presence or absence of proteasomal inhibitor (MG132) and quantified by densitometry and normalized against actin; the remaining TDP1 level was calculated relative to levels before CHX treatment. Error bars represent mean ± SEM (n = 3). (D) Representative blot showing that R586 dimethylation promotes TDP1 ubiquitylation and blocks UCHL3 interaction. FLAG-tagged TDP1 constructs (WT, R361K, or R586K) and HA-ubiquitin were co-transfected in HCT116 cells in the absence or presence of CPT (5 mM, 3 h). FLAG-TDP1 variants were immunopre- cipitated (IP) using anti-FLAG antibody, and the immune complexes were first blotted with the anti-ubiquitin-specific and anti-UCHL3 antibody and then stripped and re-probed with an anti-FLAG antibody to detect TDP1. The slowly migrating ubiquitylated TDP1 (Ub-TDP1) is indicated. Aliquots (10%) of the input show UCHL3 levels before immunoprecipitation. (E) TDP1 ubiquitylation was quantified by densitometry analysis following normalization to TDP1 and is presented as an average ±SEM (n = 3). (F) UCHL3 binding with TDP1 variants (WT, R361K, and R586K) were quantified by densitometry analysis following normalization to UCHL3 (input) and is pre- sented as an average ±SEM (n = 3). **p < 0.001, ***p < 0.0001; ns, not significant; p > 0.05; t test. (G) UCHL3 knockdown rescues ubiquitination in TDP1R586K mutant. FLAG-tagged TDP1 constructs (WT and R586K) were ectopically expressed in UCHL3 knockdown cells. FLAG-TDP1 variants were immunoprecipitated using an anti-FLAG antibody. The immune complexes were blotted with an anti-ubiquitin-spe- cific antibody (representative experiment) and then re-probed with an anti-FLAG antibody to detect TDP1. The slowly migrating ubiquitylated TDP1 (Ub-TDP1) is indicated. (H) PRMT5 overexpression abrogates UCHL3 interaction with TDP1. GFP-tagged TDP1 alone or co-transfected with FLAG-tagged PRMT5 in HCT116 cells as indicated. GFP-TDP1 was immunoprecipitated using an anti-GFP antibody, and the immune complexes were blotted with an anti-UCHL3 antibody (represen- tative experiment). Aliquots (10%) of the input show FLAG-PRMT5 and UCHL3 levels before immunoprecipitation as detected by anti-FLAG and anti-UCHL3 antibodies, respectively.

Journal: Cell reports

Article Title: Interplay between symmetric arginine dimethylation and ubiquitylation regulates TDP1 proteostasis for the repair of topoisomerase I-DNA adducts.

doi: 10.1016/j.celrep.2022.110940

Figure Lengend Snippet: Figure 3. R586 dimethylation promotes ubiquitin-dependent TDP1 proteostasis (A and B) Representative blots showing that TDP1R586K exhibits increased half-life compared with TDP1R361K in the absence of CPT. HCT116 cells were trans- fected with FLAG-TDP1R586K or FLAG-TDP1R361K and later treated with CHX for the indicated time points in the absence (A, top), or in the presence of CPT (5 mM/ 3 h; B, bottom). FLAG-tagged TDP1 levels (A and B, bottom) were determined by western blotting and quantified by densitometry normalized to actin, and the remaining TDP1 level was calculated relative to levels before CHX treatment. Error bars represent mean ± SEM (n = 3). (C) Representative blot showing that proteasomal inhibition with MG132 prevents TDP1 degradation. TDP1/ MEF cells were transfected with FLAG-TDP1 and 24 h later were treated with CHX for the indicated time points (h) in the presence or absence of proteasomal inhibitor (MG132) and quantified by densitometry and normalized against actin; the remaining TDP1 level was calculated relative to levels before CHX treatment. Error bars represent mean ± SEM (n = 3). (D) Representative blot showing that R586 dimethylation promotes TDP1 ubiquitylation and blocks UCHL3 interaction. FLAG-tagged TDP1 constructs (WT, R361K, or R586K) and HA-ubiquitin were co-transfected in HCT116 cells in the absence or presence of CPT (5 mM, 3 h). FLAG-TDP1 variants were immunopre- cipitated (IP) using anti-FLAG antibody, and the immune complexes were first blotted with the anti-ubiquitin-specific and anti-UCHL3 antibody and then stripped and re-probed with an anti-FLAG antibody to detect TDP1. The slowly migrating ubiquitylated TDP1 (Ub-TDP1) is indicated. Aliquots (10%) of the input show UCHL3 levels before immunoprecipitation. (E) TDP1 ubiquitylation was quantified by densitometry analysis following normalization to TDP1 and is presented as an average ±SEM (n = 3). (F) UCHL3 binding with TDP1 variants (WT, R361K, and R586K) were quantified by densitometry analysis following normalization to UCHL3 (input) and is pre- sented as an average ±SEM (n = 3). **p < 0.001, ***p < 0.0001; ns, not significant; p > 0.05; t test. (G) UCHL3 knockdown rescues ubiquitination in TDP1R586K mutant. FLAG-tagged TDP1 constructs (WT and R586K) were ectopically expressed in UCHL3 knockdown cells. FLAG-TDP1 variants were immunoprecipitated using an anti-FLAG antibody. The immune complexes were blotted with an anti-ubiquitin-spe- cific antibody (representative experiment) and then re-probed with an anti-FLAG antibody to detect TDP1. The slowly migrating ubiquitylated TDP1 (Ub-TDP1) is indicated. (H) PRMT5 overexpression abrogates UCHL3 interaction with TDP1. GFP-tagged TDP1 alone or co-transfected with FLAG-tagged PRMT5 in HCT116 cells as indicated. GFP-TDP1 was immunoprecipitated using an anti-GFP antibody, and the immune complexes were blotted with an anti-UCHL3 antibody (represen- tative experiment). Aliquots (10%) of the input show FLAG-PRMT5 and UCHL3 levels before immunoprecipitation as detected by anti-FLAG and anti-UCHL3 antibodies, respectively.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor Sigma-Aldrich Cat# 524636 Dithiotheriotol (DTT) Sigma-Aldrich Cat#11583786001 Magnesium Chloride SRL Cat# 69396 Protein A/G beads Santa Cruz Cat# sc-2003 Glycine Himedia Cat# MB013 Paraformaldehyde Sigma-Aldrich Cat# P6148 Potassium Chloride extrapure AR, 99.5% SRL Cat# 1649161 EDTA SRL Cat# 43272 DMSO Amresco Cat# 0231 DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 10569044 Fetal Bovine Serum Gibco (By Life Technologies) Cat# 10270106 Trypsin-EDTA (0.05%) Sigma-Aldrich Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Sigma-Aldrich Cat# 4693159001 Proteinase K Sigma-Aldrich Cat# P2308 Critical commercial assays Reverse transcription kit Applied Biosystems Cat# 4368814 QuikChange II XL site-directed mutagenesis kit Agilent Technologies Cat# 200521 Deposited Data Raw Imaging day This paper; Mandeley data https://doi.org/10.17632/wpnpxn9brh.1 Experimental models: Cell lines TDP1-/- MEFs Dr Cornelius F Boerkoel (Centre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, British Columbia, Canada) N/A HCT116 Developmental Therapeutics Program (NCI, NIH) N/A HEK293 ATCC Cat# CRL-1573 HCT116- PRMT5 KO This Paper N/A Oligonucleotides Prmt5 gRNA CCTGAATTGCGTCCCCGAAATAG This paper N/A UCHL3 siRNA GAUACCUGGAGAACUAUGA Genx M_001270952 Primers for Human TDP1 (Forward: GACGTG GACTGGCTCGTAAA Reverse: GAGCCTTAGCCTCTCTCGCTTATC) This paper N/A Primers for Human Actin (ForwardGACCCAGA TCATGTTTGAGACC Reverse: CATCACGATGCCAGTGGTAC) (Ghosh et al., 2019) N/A Fluorescence based ex vivo assay- ssDNA (HEI40) 56-FAM/AGA GGA TCT AAA AGA CTT/3BHQ (Flett et al., 2018) N/A Fluorescence based ex vivo assay- dsDNA (HEI50) 56-FAM/AAG TCT TTT AGA TCC CTC CGG ATC TAA AAG ACT T/3BHQ (Flett et al., 2018) N/A Fluorescence anisotropy (HEI41-3P) 56-FAM/AGA GGA TCT AAA AGA CTT-3P (Dexheimer et al., 2010) N/A Fluorescence anisotropy (HEI41-3C) 5’ AAGTCTTTTAGATCCTCT 3’ This paper N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene Cat#48138 pCMV-Tag2B-TDP1 WT (FLAGTDP1WT) (Das et al., 2009) N/A (Continued on next page) e2 Cell Reports 39, 110940, June 14, 2022

Techniques: Ubiquitin Proteomics, Western Blot, Inhibition, Transfection, Construct, Immunoprecipitation, Binding Assay, Knockdown, Mutagenesis, Over Expression

Figure 4. Dimethylation of TDP1 at R586 recruits XRCC1 at Top1cc damage sites (A and B) R586 dimethylation promotes TDP1 binding to XRCC1. FLAG- tagged TDP1 constructs (WT, R361K, or R586K) were ectopically expressed in HCT116 cells in the absence or presence of CPT (5 mM, 3 h) (A). FLAG- TDP1 variants were immunoprecipitated using anti-FLAG antibody. Immune complexes were blotted with anti-XRCC1-specific antibody and quantified by densitometry (B); Error bars represent mean ± SEM (n = 3). The blot was then stripped and re-probed with an anti-FLAG antibody to show equal loading. Aliquots (10%) of the input show the level of XRCC1 before immuno- precipitation. (C) CPT-induced XRCC1 foci formation in TDP1–/– MEFs cells expressing FLAG-TDP1WT and FLAG-TDP1R586K or vector control (TDP–/–). Representa- tive confocal images of XRCC1 foci formation induced by CPT (5 mM, 3 h). XRCC1 foci are shown in green, and nuclei are stained with DAPI. (Scale bar, 5 mm). (D) XRCC1 foci per nucleus (marked in dotted circles) was calculated for 20–25 cells using ImageJ software. (E) Representative western blot showing the equal level of ectopic expression of FLAG-tagged TDP1 variants and endogenous XRCC1 level in TDP1/

Journal: Cell reports

Article Title: Interplay between symmetric arginine dimethylation and ubiquitylation regulates TDP1 proteostasis for the repair of topoisomerase I-DNA adducts.

doi: 10.1016/j.celrep.2022.110940

Figure Lengend Snippet: Figure 4. Dimethylation of TDP1 at R586 recruits XRCC1 at Top1cc damage sites (A and B) R586 dimethylation promotes TDP1 binding to XRCC1. FLAG- tagged TDP1 constructs (WT, R361K, or R586K) were ectopically expressed in HCT116 cells in the absence or presence of CPT (5 mM, 3 h) (A). FLAG- TDP1 variants were immunoprecipitated using anti-FLAG antibody. Immune complexes were blotted with anti-XRCC1-specific antibody and quantified by densitometry (B); Error bars represent mean ± SEM (n = 3). The blot was then stripped and re-probed with an anti-FLAG antibody to show equal loading. Aliquots (10%) of the input show the level of XRCC1 before immuno- precipitation. (C) CPT-induced XRCC1 foci formation in TDP1–/– MEFs cells expressing FLAG-TDP1WT and FLAG-TDP1R586K or vector control (TDP–/–). Representa- tive confocal images of XRCC1 foci formation induced by CPT (5 mM, 3 h). XRCC1 foci are shown in green, and nuclei are stained with DAPI. (Scale bar, 5 mm). (D) XRCC1 foci per nucleus (marked in dotted circles) was calculated for 20–25 cells using ImageJ software. (E) Representative western blot showing the equal level of ectopic expression of FLAG-tagged TDP1 variants and endogenous XRCC1 level in TDP1/

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor Sigma-Aldrich Cat# 524636 Dithiotheriotol (DTT) Sigma-Aldrich Cat#11583786001 Magnesium Chloride SRL Cat# 69396 Protein A/G beads Santa Cruz Cat# sc-2003 Glycine Himedia Cat# MB013 Paraformaldehyde Sigma-Aldrich Cat# P6148 Potassium Chloride extrapure AR, 99.5% SRL Cat# 1649161 EDTA SRL Cat# 43272 DMSO Amresco Cat# 0231 DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 10569044 Fetal Bovine Serum Gibco (By Life Technologies) Cat# 10270106 Trypsin-EDTA (0.05%) Sigma-Aldrich Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Sigma-Aldrich Cat# 4693159001 Proteinase K Sigma-Aldrich Cat# P2308 Critical commercial assays Reverse transcription kit Applied Biosystems Cat# 4368814 QuikChange II XL site-directed mutagenesis kit Agilent Technologies Cat# 200521 Deposited Data Raw Imaging day This paper; Mandeley data https://doi.org/10.17632/wpnpxn9brh.1 Experimental models: Cell lines TDP1-/- MEFs Dr Cornelius F Boerkoel (Centre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, British Columbia, Canada) N/A HCT116 Developmental Therapeutics Program (NCI, NIH) N/A HEK293 ATCC Cat# CRL-1573 HCT116- PRMT5 KO This Paper N/A Oligonucleotides Prmt5 gRNA CCTGAATTGCGTCCCCGAAATAG This paper N/A UCHL3 siRNA GAUACCUGGAGAACUAUGA Genx M_001270952 Primers for Human TDP1 (Forward: GACGTG GACTGGCTCGTAAA Reverse: GAGCCTTAGCCTCTCTCGCTTATC) This paper N/A Primers for Human Actin (ForwardGACCCAGA TCATGTTTGAGACC Reverse: CATCACGATGCCAGTGGTAC) (Ghosh et al., 2019) N/A Fluorescence based ex vivo assay- ssDNA (HEI40) 56-FAM/AGA GGA TCT AAA AGA CTT/3BHQ (Flett et al., 2018) N/A Fluorescence based ex vivo assay- dsDNA (HEI50) 56-FAM/AAG TCT TTT AGA TCC CTC CGG ATC TAA AAG ACT T/3BHQ (Flett et al., 2018) N/A Fluorescence anisotropy (HEI41-3P) 56-FAM/AGA GGA TCT AAA AGA CTT-3P (Dexheimer et al., 2010) N/A Fluorescence anisotropy (HEI41-3C) 5’ AAGTCTTTTAGATCCTCT 3’ This paper N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene Cat#48138 pCMV-Tag2B-TDP1 WT (FLAGTDP1WT) (Das et al., 2009) N/A (Continued on next page) e2 Cell Reports 39, 110940, June 14, 2022

Techniques: Binding Assay, Construct, Immunoprecipitation, Expressing, Plasmid Preparation, Control, Staining, Software, Western Blot

GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Activation Assay, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot, Binding Assay, Incubation

MEP50/PRMT5 complex supports GLI1 activation through GLI1 stabilisation downstream of the HH signalling pathway. a–c Endogenous GLI1/MEP50/PRMT5 complex in C3H10T1/2 cells. Cells were treated with SAG for 36 h, and complex was detected by immunoprecipitation (IP) with anti-PRMT5 (D5P2T) ( a ), anti-MEP50 (ERP10708 [B]) ( b ), or anti-GLI1 (V812) ( c ) antibodies, followed by immunoblot (IB) with antibodies against indicated proteins. d Dissociation of PRMT5 and GLI1 in stable MEP50 knockdown C3H10T1/2 cells by siMEP50-m2. Cells were treated with SAG for 48 h and treated with 50 μM MG132 for 4 h. GLI1/PRMT5 complex was detected by immunoprecipitation with anti-PRMT5 (D5P2T) or anti-GLI1 (V812) antibodies, followed by immunoblot with indicated antibodies. e Immunoblot of endogenous GLI1 in C3H10T1/2 cells expressing MEP50 siRNAs (siMEP50-m1 or siMEP50-m2). f Immunoblot of endogenous GLI1 in C3H10T1/2 cells expressing two independent PRMT5 siRNAs. g Immunoblot of nuclear and cytoplasmic GLI1 and MEP50 in stable MEP50-knockdown (siMEP50-m2) or control siGFP-expressing cells treated with 300 nM SAG. Cells were treated with SAG for 24 h and separated into cytosol and nucleus fractions. h Immunoblot analysis of endogenous nuclear and cytoplasmic GLI1 and PRMT5 in stable PRMT5-knockdown (siPRMT5-m2) C3H10T1/2 cells. Cells were treated with 300 nM SAG for 24 h and then separated as in h . i In vivo ubiquitination of GLI1 in C3H10T1/2 cells with or without expression of siMEP50. FLAG-ubiquitin was transfected into C3H10T1/2 cells. After 48 h of transfection, then cells were treated with 50 µM MG132 for 4 h. Endogenous ubiquitinated GLI1 was immunoprecipitated with an anti-GLI1 (C-1) antibody, followed by immunoblotting with indicated antibodies. j In vivo ubiquitination of GLI1 in C3H10T1/2 cells with exogenous expression of PRMT5 or MEP50. FLAG-ubiquitin and HA-PRMT5, HA-PRMT5 G367A/R368A (inactive form of PRMT5), or Myc-MEP50 were transfected into C3H10T1/2 cells. After 48 h, the cells were treated with 50 µM MG132 for 4 h. Endogenous ubiquitinated GLI1 was detected as described in i . In a , i and j , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: MEP50/PRMT5 complex supports GLI1 activation through GLI1 stabilisation downstream of the HH signalling pathway. a–c Endogenous GLI1/MEP50/PRMT5 complex in C3H10T1/2 cells. Cells were treated with SAG for 36 h, and complex was detected by immunoprecipitation (IP) with anti-PRMT5 (D5P2T) ( a ), anti-MEP50 (ERP10708 [B]) ( b ), or anti-GLI1 (V812) ( c ) antibodies, followed by immunoblot (IB) with antibodies against indicated proteins. d Dissociation of PRMT5 and GLI1 in stable MEP50 knockdown C3H10T1/2 cells by siMEP50-m2. Cells were treated with SAG for 48 h and treated with 50 μM MG132 for 4 h. GLI1/PRMT5 complex was detected by immunoprecipitation with anti-PRMT5 (D5P2T) or anti-GLI1 (V812) antibodies, followed by immunoblot with indicated antibodies. e Immunoblot of endogenous GLI1 in C3H10T1/2 cells expressing MEP50 siRNAs (siMEP50-m1 or siMEP50-m2). f Immunoblot of endogenous GLI1 in C3H10T1/2 cells expressing two independent PRMT5 siRNAs. g Immunoblot of nuclear and cytoplasmic GLI1 and MEP50 in stable MEP50-knockdown (siMEP50-m2) or control siGFP-expressing cells treated with 300 nM SAG. Cells were treated with SAG for 24 h and separated into cytosol and nucleus fractions. h Immunoblot analysis of endogenous nuclear and cytoplasmic GLI1 and PRMT5 in stable PRMT5-knockdown (siPRMT5-m2) C3H10T1/2 cells. Cells were treated with 300 nM SAG for 24 h and then separated as in h . i In vivo ubiquitination of GLI1 in C3H10T1/2 cells with or without expression of siMEP50. FLAG-ubiquitin was transfected into C3H10T1/2 cells. After 48 h of transfection, then cells were treated with 50 µM MG132 for 4 h. Endogenous ubiquitinated GLI1 was immunoprecipitated with an anti-GLI1 (C-1) antibody, followed by immunoblotting with indicated antibodies. j In vivo ubiquitination of GLI1 in C3H10T1/2 cells with exogenous expression of PRMT5 or MEP50. FLAG-ubiquitin and HA-PRMT5, HA-PRMT5 G367A/R368A (inactive form of PRMT5), or Myc-MEP50 were transfected into C3H10T1/2 cells. After 48 h, the cells were treated with 50 µM MG132 for 4 h. Endogenous ubiquitinated GLI1 was detected as described in i . In a , i and j , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Activation Assay, Immunoprecipitation, Western Blot, Knockdown, Expressing, Control, In Vivo, Ubiquitin Proteomics, Transfection

MEP50/PRMT5 complex-mediated GLI1 stabilisation enhances Gli transcriptional activity and HH signalling pathway activation induces PRMT5 and MEP50 expression. a Gli transcriptional activity in PRMT5 or MEP50 knockdown cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. A multimerized Gli-binding site luciferase reporter plasmid and phRL-TK control reporter plasmid were transfected into C3H10T1/2 cells. After 24 h of incubation, 300 nM SAG was applied for 24 h, and then luciferase assays were performed. b qRT-PCR analysis of Ptch1 , Bcl2 , and Foxm1 expression in C3H10T1/2 cells with MEP50 knockdown or PRMT5 knockdown and treated with 300 nM SAG for the indicated times. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. c Gli transcriptional activity in HA-PRMT5 or Myc-MEP50-expressing cells. HA-PRMT5, HA-PRMT5 G367A/R368A, or Myc-MEP50 and a multimerized Gli-binding site luciferase reporter plasmid and phRL-TK control reporter plasmid were transfected into C3H10T1/2 cells. After 24 h of incubation, 300 nM SAG was applied for 24 h, and then luciferase assays were performed. d qRT-PCR analysis of Ptch1 , Bcl2 , and Foxm1 expression in HA-PRMT5 or Myc-MEP50-expressing C3H10T1/2 cells. HA-PRMT5, HA-PRMT5 G367A/R368A, or Myc-MEP50 plasmids were transfected into C3H10T1/2 cells. After 24 h of incubation, cells were separated equally, and DMSO (−) or 300 nM SAG (+) were applied for 24 h. Protein levels are shown in Supplementary Fig. . e and f qRT-PCR analysis of PRMT5 ( e ) and MEP50 ( f ) mRNA expression in C3H10T1/2 cells after 24 h of treatment with 300 nM SAG. In a – c , data represent one of two independent experiments with similar results. In e and f , data represent one of three independent experiments with similar results. The source data is shown in Supplementary Data

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: MEP50/PRMT5 complex-mediated GLI1 stabilisation enhances Gli transcriptional activity and HH signalling pathway activation induces PRMT5 and MEP50 expression. a Gli transcriptional activity in PRMT5 or MEP50 knockdown cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. A multimerized Gli-binding site luciferase reporter plasmid and phRL-TK control reporter plasmid were transfected into C3H10T1/2 cells. After 24 h of incubation, 300 nM SAG was applied for 24 h, and then luciferase assays were performed. b qRT-PCR analysis of Ptch1 , Bcl2 , and Foxm1 expression in C3H10T1/2 cells with MEP50 knockdown or PRMT5 knockdown and treated with 300 nM SAG for the indicated times. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. c Gli transcriptional activity in HA-PRMT5 or Myc-MEP50-expressing cells. HA-PRMT5, HA-PRMT5 G367A/R368A, or Myc-MEP50 and a multimerized Gli-binding site luciferase reporter plasmid and phRL-TK control reporter plasmid were transfected into C3H10T1/2 cells. After 24 h of incubation, 300 nM SAG was applied for 24 h, and then luciferase assays were performed. d qRT-PCR analysis of Ptch1 , Bcl2 , and Foxm1 expression in HA-PRMT5 or Myc-MEP50-expressing C3H10T1/2 cells. HA-PRMT5, HA-PRMT5 G367A/R368A, or Myc-MEP50 plasmids were transfected into C3H10T1/2 cells. After 24 h of incubation, cells were separated equally, and DMSO (−) or 300 nM SAG (+) were applied for 24 h. Protein levels are shown in Supplementary Fig. . e and f qRT-PCR analysis of PRMT5 ( e ) and MEP50 ( f ) mRNA expression in C3H10T1/2 cells after 24 h of treatment with 300 nM SAG. In a – c , data represent one of two independent experiments with similar results. In e and f , data represent one of three independent experiments with similar results. The source data is shown in Supplementary Data

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Activity Assay, Activation Assay, Expressing, Knockdown, Stable Transfection, Recombinant, Binding Assay, Luciferase, Plasmid Preparation, Control, Transfection, Incubation, Quantitative RT-PCR

MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig.

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Methylation, Knockdown, Stable Transfection, Recombinant, Transfection, Cell Culture, Immunoprecipitation, Western Blot, In Vitro, Expressing, Plasmid Preparation, Incubation, Mutagenesis, Staining

MEP50/PRMT5 complex-mediated GLI1 methylation inhibits the interaction of GLI1 with its E3 ligase complex, ITCH/NUMB, resulting in GLI1 stabilisation. a Interaction of GLI1 and endogenous ITCH or NUMB from stably PRMT5-knockdown or MEP50-knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. MG132 (50 μM) was applied for 4 h before harvesting. b Interaction of GLI1 mutants with endogenous ITCH or NUMB in C3H10T1/2 cells. The cells were transfected as indicated. At 48 h post-transfection, 50 μM MG132 was applied for 4 h, and then the cells were lysed and subjected to immunoprecipitation with an anti-HA antibody, followed by immunoblotting with antibodies against the indicated proteins. c In vivo ubiquitination of HA-GLI1-RK mutants. Cells were transfected and cultured for 24 h, followed by treatment with 50 µM MG132 for 4 h before harvesting. Ubiquitinated GLI1 was detected by immuoprecipitation with an anti-HA (3F10) antibody and immunoblotting with anti-FLAG (upper panel) or anti-HA (lower panel) antibodies. The asterisk denotes non-specific bands. d Schematic diagram of the mechanism of PRMT5/MEP50-mediated GLI1 stabilisation. When the HH signalling pathway inactivates, the ITCH/NUMB E3 ligase complex binds to and ubiquitinates GLI1 for proteasomal degradation. In turn, under HH signalling pathway activation, the MEP50/PRMT5 complex methylates GLI1 to dissociate the ITCH/NUMB complex from GLI1, resulting in GLI1 stabilisation. Unprocessed original scans of blots are shown in Supplementary Fig.

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: MEP50/PRMT5 complex-mediated GLI1 methylation inhibits the interaction of GLI1 with its E3 ligase complex, ITCH/NUMB, resulting in GLI1 stabilisation. a Interaction of GLI1 and endogenous ITCH or NUMB from stably PRMT5-knockdown or MEP50-knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. MG132 (50 μM) was applied for 4 h before harvesting. b Interaction of GLI1 mutants with endogenous ITCH or NUMB in C3H10T1/2 cells. The cells were transfected as indicated. At 48 h post-transfection, 50 μM MG132 was applied for 4 h, and then the cells were lysed and subjected to immunoprecipitation with an anti-HA antibody, followed by immunoblotting with antibodies against the indicated proteins. c In vivo ubiquitination of HA-GLI1-RK mutants. Cells were transfected and cultured for 24 h, followed by treatment with 50 µM MG132 for 4 h before harvesting. Ubiquitinated GLI1 was detected by immuoprecipitation with an anti-HA (3F10) antibody and immunoblotting with anti-FLAG (upper panel) or anti-HA (lower panel) antibodies. The asterisk denotes non-specific bands. d Schematic diagram of the mechanism of PRMT5/MEP50-mediated GLI1 stabilisation. When the HH signalling pathway inactivates, the ITCH/NUMB E3 ligase complex binds to and ubiquitinates GLI1 for proteasomal degradation. In turn, under HH signalling pathway activation, the MEP50/PRMT5 complex methylates GLI1 to dissociate the ITCH/NUMB complex from GLI1, resulting in GLI1 stabilisation. Unprocessed original scans of blots are shown in Supplementary Fig.

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Methylation, Stable Transfection, Knockdown, Recombinant, Transfection, Immunoprecipitation, Western Blot, In Vivo, Ubiquitin Proteomics, Cell Culture, Activation Assay

PRMT5 and MEP50 expression is upregulated in HH pathway-activated cancers, and PRMT5 inhibition is a potential therapeutic strategy for such cancers. a , b Immunoblot analysis of endogenous GLI1 in H146 and AGS cells stably expressing PRMT5 ( a ) or MEP50 ( b ) siRNAs. c Immunoblot analysis of endogenous GLI1 in H146 cells stably expressing GLI1 siRNA. In a – c , siRNAs were stably expressed via recombinant retroviruses. d Growth curves of PRMT5, MEP50, and GLI1-knockdown H146 SCLC cells. Results are shown in the mean ± s.d. of triplicate experiments. e A quantitative colony formation assay was performed by plating cells at a density of 1 × 10 4 cells in a six-well plate and incubating them for 14 days. Surviving colonies were counted and represented as the mean ± s.d. of three independent wells. In d and e , siMEP50, siPRMT5, or siGLI1 was stably expressed via recombinant retrovirus in H146 cells. f , g IC 50 values of cyclopamine in PRMT5-knockdown or MEP50-knockdown AGS cells. siRNAs were stably expressed via recombinant retroviruses. Cell viability ( e ) is shown as the mean ± s.d. n = 4. IC 50 values of cyclopamine are shown in g . h – j Upregulated expression of PRMT5 , MEP50 , and GLI1 target genes in small cell lung carcinoma ( h ), gastric adenocarcinoma ( i ), and skin basal cell carcinoma ( j ) from the ONCOMINE database ( https://www.oncomine.org/ ). The threshold of data was p ≤ 0.05. Each boxplot shows the log maximum, minimum, and median signal intensity of each mRNA from the corresponding expression array. Bold lines on each boxplot define the median value. P -values and sample numbers are indicated in each panel. Unprocessed original scans of blots are shown in Supplementary Fig. . Source data of d – f is shown in Supplementary Data

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: PRMT5 and MEP50 expression is upregulated in HH pathway-activated cancers, and PRMT5 inhibition is a potential therapeutic strategy for such cancers. a , b Immunoblot analysis of endogenous GLI1 in H146 and AGS cells stably expressing PRMT5 ( a ) or MEP50 ( b ) siRNAs. c Immunoblot analysis of endogenous GLI1 in H146 cells stably expressing GLI1 siRNA. In a – c , siRNAs were stably expressed via recombinant retroviruses. d Growth curves of PRMT5, MEP50, and GLI1-knockdown H146 SCLC cells. Results are shown in the mean ± s.d. of triplicate experiments. e A quantitative colony formation assay was performed by plating cells at a density of 1 × 10 4 cells in a six-well plate and incubating them for 14 days. Surviving colonies were counted and represented as the mean ± s.d. of three independent wells. In d and e , siMEP50, siPRMT5, or siGLI1 was stably expressed via recombinant retrovirus in H146 cells. f , g IC 50 values of cyclopamine in PRMT5-knockdown or MEP50-knockdown AGS cells. siRNAs were stably expressed via recombinant retroviruses. Cell viability ( e ) is shown as the mean ± s.d. n = 4. IC 50 values of cyclopamine are shown in g . h – j Upregulated expression of PRMT5 , MEP50 , and GLI1 target genes in small cell lung carcinoma ( h ), gastric adenocarcinoma ( i ), and skin basal cell carcinoma ( j ) from the ONCOMINE database ( https://www.oncomine.org/ ). The threshold of data was p ≤ 0.05. Each boxplot shows the log maximum, minimum, and median signal intensity of each mRNA from the corresponding expression array. Bold lines on each boxplot define the median value. P -values and sample numbers are indicated in each panel. Unprocessed original scans of blots are shown in Supplementary Fig. . Source data of d – f is shown in Supplementary Data

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Expressing, Inhibition, Western Blot, Stable Transfection, Recombinant, Knockdown, Colony Assay

Primer sequences used for  PRMT5  and MEP50 cloning

Journal: Communications Biology

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

doi: 10.1038/s42003-018-0275-4

Figure Lengend Snippet: Primer sequences used for PRMT5 and MEP50 cloning

Article Snippet: The TaqMan gene expression assays used for mouse samples were Ptch1 (Mm01306905_m1), Gli1 (Mm00494645_m1), Foxm1 (Mm00514924_m1), Bcl2 (Mm00477631_m1), Mep50 (Mm01296589_g1), and Prmt5 (Mm00550472_m1).

Techniques: Sequencing

A PRMT5 plasmid was transfected into HEK293 and Tu686 cells. After incubated for 48 h, cell lysates were measured by Immunoprecipitation (IP) assays using anti-PRMT5 beads, and the silver staining showed the location of PRMT5 and its associated protein G3BP2. Lane 1,3 for HEK293 cell. Lane 2,4 for Tu686 cell. B , C Co-immunoprecipitation (Co-IP) of PRMT5 and G3BP2 was performed in HEK293 cells. IgG was used as a negative control. D Association of PRMT5 with G3BP2 were verified by Co-IP assay with anti-Flag in Tu212 cells transfected with Flag-PRMT5 or Flag-G3BP2, respectively. E Schematic diagram showed the structure of PRMT5 (left) and the deletion constructs were co-transfected with Flag-G3BP2 into HEK293 cells. Cell lysates were precipitated with GST beads. G3BP2 was blotted with an anti-Flag antibody. Immunoblotting and Coomassie Brilliant blue staining were shown. F The methylation of G3BP2 was detected by western blot analysis using a custom-made methy-G3BP2 antibody in HEK293 and Tu212 cells transfected with or without PRMT5 plasmid. G Methylation site of G3BP2 was examined by liquid chromatography- mass spectrometry (LC-MS). R represents potential methylation site. H Sequences of the evolutionarily conserved residue R468 (red) in G3BP2. I Validation of R468 as the PRMT5-catalyzed G3BP2 methylation site in Tu212 and Tu686 cells. J In vitro methylation of G3BP2 in the presence of 3 H-SAM. Recombinant GST-G3BP2-WT and G3BP2-R468K proteins were purified from bacteria and Flag-PRMT5 proteins were immunopurified from HEK293 cells. K Tu686 cells were treated with the indicated amounts of GSK3326595 for 24 h, protein levels of G3BP2 and methy-G3BP2 were assessed by western blot.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A PRMT5 plasmid was transfected into HEK293 and Tu686 cells. After incubated for 48 h, cell lysates were measured by Immunoprecipitation (IP) assays using anti-PRMT5 beads, and the silver staining showed the location of PRMT5 and its associated protein G3BP2. Lane 1,3 for HEK293 cell. Lane 2,4 for Tu686 cell. B , C Co-immunoprecipitation (Co-IP) of PRMT5 and G3BP2 was performed in HEK293 cells. IgG was used as a negative control. D Association of PRMT5 with G3BP2 were verified by Co-IP assay with anti-Flag in Tu212 cells transfected with Flag-PRMT5 or Flag-G3BP2, respectively. E Schematic diagram showed the structure of PRMT5 (left) and the deletion constructs were co-transfected with Flag-G3BP2 into HEK293 cells. Cell lysates were precipitated with GST beads. G3BP2 was blotted with an anti-Flag antibody. Immunoblotting and Coomassie Brilliant blue staining were shown. F The methylation of G3BP2 was detected by western blot analysis using a custom-made methy-G3BP2 antibody in HEK293 and Tu212 cells transfected with or without PRMT5 plasmid. G Methylation site of G3BP2 was examined by liquid chromatography- mass spectrometry (LC-MS). R represents potential methylation site. H Sequences of the evolutionarily conserved residue R468 (red) in G3BP2. I Validation of R468 as the PRMT5-catalyzed G3BP2 methylation site in Tu212 and Tu686 cells. J In vitro methylation of G3BP2 in the presence of 3 H-SAM. Recombinant GST-G3BP2-WT and G3BP2-R468K proteins were purified from bacteria and Flag-PRMT5 proteins were immunopurified from HEK293 cells. K Tu686 cells were treated with the indicated amounts of GSK3326595 for 24 h, protein levels of G3BP2 and methy-G3BP2 were assessed by western blot.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Plasmid Preparation, Transfection, Incubation, Immunoprecipitation, Silver Staining, Co-Immunoprecipitation Assay, Negative Control, Construct, Western Blot, Staining, Methylation, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Residue, Biomarker Discovery, In Vitro, Recombinant, Purification, Bacteria

A , B Western blot and qPCR analysis of G3BP2 and PRMT5 expression in Tu686 and Tu212 cells transfected with siNC or siPRMT5. ns, no significant difference, ** P < 0.01. C Tu686 cells were transfected with PRMT5 siRNAs and then incubated with or without MG132 (40 μM) for 6 h. Cell lysates were analyzed by immunoblotting. D Tu686 cells were transfected with negative control or PRMT5 siRNA and then applied with Cycloheximide (CHX, 50 μg/ml) for 2, 4 or 6 h. Immunoblotting analysis was used to measure the expression of G3BP2. * P < 0.05. E Cell lysates were immunoprecipitated with Flag-tag antibody and then immunoblotted by HA-tag antibody. F Cell lysates were immunoprecipitated with G3BP2 antibody before immunoblotting with HA-tag antibody. G HEK293 cells were transfected different deubiquitinating enzymes (DUBs) and then lysed for immunoblotting to detect the expression of G3BP2. H HEK293 cells were co-transfected with the indicated vectors for 48 h, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-Flag antibody and immunoblotting with anti-Myc antibody. I , J Western blot and RT-PCR analysis of USP7 expression in Tu212 and Tu686 cells transfected with siNC or siUSP7. ns, no significant difference. K Tu686 cells were transfected with negative control or USP7 siRNA and then applied with 50 μg/ml CHX for the indicated times and cell lysates were assessed by immunoblotting. * P < 0.05. L Western blot analysis of Tu686 and Tu212 cells with or without P5091, followed by treatment with DMSO and MG132 for 6 h, respectively. M Tu212 cells were transfected with G3BP2 and HA-Ub plasmids for 48 h, the purified G3BP2-Ubn was added 40 ng or 80 ng recombinant GST-USP7 proteins before immunoblotting analysis. N USP7 knockdown in Tu686 cells increased G3BP2 ubiquitination. Tu686 cells were co-transfected with HA-Ub and USP7 siRNA or control siRNAs, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated using an anti-G3BP2 antibody and then subjected to immunoblotting.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A , B Western blot and qPCR analysis of G3BP2 and PRMT5 expression in Tu686 and Tu212 cells transfected with siNC or siPRMT5. ns, no significant difference, ** P < 0.01. C Tu686 cells were transfected with PRMT5 siRNAs and then incubated with or without MG132 (40 μM) for 6 h. Cell lysates were analyzed by immunoblotting. D Tu686 cells were transfected with negative control or PRMT5 siRNA and then applied with Cycloheximide (CHX, 50 μg/ml) for 2, 4 or 6 h. Immunoblotting analysis was used to measure the expression of G3BP2. * P < 0.05. E Cell lysates were immunoprecipitated with Flag-tag antibody and then immunoblotted by HA-tag antibody. F Cell lysates were immunoprecipitated with G3BP2 antibody before immunoblotting with HA-tag antibody. G HEK293 cells were transfected different deubiquitinating enzymes (DUBs) and then lysed for immunoblotting to detect the expression of G3BP2. H HEK293 cells were co-transfected with the indicated vectors for 48 h, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-Flag antibody and immunoblotting with anti-Myc antibody. I , J Western blot and RT-PCR analysis of USP7 expression in Tu212 and Tu686 cells transfected with siNC or siUSP7. ns, no significant difference. K Tu686 cells were transfected with negative control or USP7 siRNA and then applied with 50 μg/ml CHX for the indicated times and cell lysates were assessed by immunoblotting. * P < 0.05. L Western blot analysis of Tu686 and Tu212 cells with or without P5091, followed by treatment with DMSO and MG132 for 6 h, respectively. M Tu212 cells were transfected with G3BP2 and HA-Ub plasmids for 48 h, the purified G3BP2-Ubn was added 40 ng or 80 ng recombinant GST-USP7 proteins before immunoblotting analysis. N USP7 knockdown in Tu686 cells increased G3BP2 ubiquitination. Tu686 cells were co-transfected with HA-Ub and USP7 siRNA or control siRNAs, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated using an anti-G3BP2 antibody and then subjected to immunoblotting.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Western Blot, Expressing, Transfection, Incubation, Negative Control, Immunoprecipitation, FLAG-tag, Reverse Transcription Polymerase Chain Reaction, Purification, Recombinant, Knockdown, Ubiquitin Proteomics, Control

A A series of G3BP2 constructs were co-transfected with HA-USP7 plasmid into HEK293 cells. Cell lysates were immunoprecipitated with anti-Flag antibody and then analyzed by immunoblotting with HA-USP7 antibody. B , C Tu686 cells were transfected with either negative control siRNA or PRMT5 siRNA, then treated with 40 μΜ MG132 for 6 h. Cell lysates were immunoprecipitated with anti-USP7 or G3BP2 antibody, followed by immunoblotting analysis. D Flag-G3BP2 wild type or R468K mutant was co-transfected with PRMT5 and HA-USP7 into HEK293 cells, and then treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-HA antibody then analyzed by immunoblotting using anti-Flag antibody. E Cells were transfected with Myc-Ub and HA-USP7 and negative control siRNA or PRMT5 siRNA, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-G3BP2 antibody then analyzed by immunoblotting. F Flag-G3BP2 wild type or R468K mutant, Myc-Ub and PRMT5 were co-transfected into HEK293 cells, and then treated with MG132 for 6 h. Cell lysates were immunoprecipitated using anti-Flag antibody and then analyzed by immunoblotting using anti-Myc antibody.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A A series of G3BP2 constructs were co-transfected with HA-USP7 plasmid into HEK293 cells. Cell lysates were immunoprecipitated with anti-Flag antibody and then analyzed by immunoblotting with HA-USP7 antibody. B , C Tu686 cells were transfected with either negative control siRNA or PRMT5 siRNA, then treated with 40 μΜ MG132 for 6 h. Cell lysates were immunoprecipitated with anti-USP7 or G3BP2 antibody, followed by immunoblotting analysis. D Flag-G3BP2 wild type or R468K mutant was co-transfected with PRMT5 and HA-USP7 into HEK293 cells, and then treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-HA antibody then analyzed by immunoblotting using anti-Flag antibody. E Cells were transfected with Myc-Ub and HA-USP7 and negative control siRNA or PRMT5 siRNA, followed by treated with MG132 for 6 h. Cell lysates were immunoprecipitated with anti-G3BP2 antibody then analyzed by immunoblotting. F Flag-G3BP2 wild type or R468K mutant, Myc-Ub and PRMT5 were co-transfected into HEK293 cells, and then treated with MG132 for 6 h. Cell lysates were immunoprecipitated using anti-Flag antibody and then analyzed by immunoblotting using anti-Myc antibody.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Construct, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot, Negative Control, Mutagenesis

A The KEGG pathway analysis of the lipid metabolism-associated pathway affected by G3BP2 in Tu212 cells. B The KEGG pathway enrichment analysis of G3BP2-conferred metabolism pathways in Tu212 cells. C The effect of G3BP2-WT or G3BP2-R468K on the expression of lipid metabolism-associated genes were measured by RT-PCR analysis in Tu212 cells. D The effect of G3BP2-WT and G3BP2-R468K on the lipid metabolism-associated proteins were measured by immunoblotting analysis. E ACLY and FASN luciferase activity were determined by co-transfected with PRMT5-WT/PRMT5-MUT and pSV- Renilla to Tu686 cells. Luciferase activities were measured 60 h later. ACSL3 gene was used as an negative control. F , G The G3BP2-WT or G3BP2-R468K along with ACLY and FASN luciferase reporter plasmids were co-transfected into HEK293 or Tu686-PRMT5(KO) cells for 60 h. The luciferase activities were analyzed by dual-luciferase reporter assay, and normalized to the activity of Renilla. The data are presented as the mean ± SD; ns no significant difference; * P < 0.05; ** P < 0.01,*** P < 0.001.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A The KEGG pathway analysis of the lipid metabolism-associated pathway affected by G3BP2 in Tu212 cells. B The KEGG pathway enrichment analysis of G3BP2-conferred metabolism pathways in Tu212 cells. C The effect of G3BP2-WT or G3BP2-R468K on the expression of lipid metabolism-associated genes were measured by RT-PCR analysis in Tu212 cells. D The effect of G3BP2-WT and G3BP2-R468K on the lipid metabolism-associated proteins were measured by immunoblotting analysis. E ACLY and FASN luciferase activity were determined by co-transfected with PRMT5-WT/PRMT5-MUT and pSV- Renilla to Tu686 cells. Luciferase activities were measured 60 h later. ACSL3 gene was used as an negative control. F , G The G3BP2-WT or G3BP2-R468K along with ACLY and FASN luciferase reporter plasmids were co-transfected into HEK293 or Tu686-PRMT5(KO) cells for 60 h. The luciferase activities were analyzed by dual-luciferase reporter assay, and normalized to the activity of Renilla. The data are presented as the mean ± SD; ns no significant difference; * P < 0.05; ** P < 0.01,*** P < 0.001.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Luciferase, Activity Assay, Transfection, Negative Control, Reporter Assay

A , B The levels of triglycerides, fatty acids and cholesterols were measured after transfected with indicated plasmids, such as pcDNA3.1-G3BP2-WT, pcDNA3.1-G3BP2-R468K, pcDNA3.1-PRMT5, pcDNA3.1-PRMT5 + G3BP2-WT or pcDNA3.1-PRMT5 + G3BP2-R468K, in PRMT5-knockout Tu686 cells. C , D The effect of G3BP2 inhibition or overexpression on lipogenesis was determined by Oil Red O staining in Tu686 and PRMT5-knockout Tu686 cells. Quantification of lipid droplets were performed by Image J. Scale bar: 75 μm, 25 μm. E , F Representative images and quantification of G3BP2 or G3BP2R468K with or without PRMT5 on lipogenesis by Oil Red O staining in PRMT5-knockout cells. Scale bar: 75 μm. PRMT5i for PRMT5 inhibitor. The data are presented as the mean ± SD; ns no significant difference, * P < 0.05; ** P < 0.01,*** P < 0.001.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A , B The levels of triglycerides, fatty acids and cholesterols were measured after transfected with indicated plasmids, such as pcDNA3.1-G3BP2-WT, pcDNA3.1-G3BP2-R468K, pcDNA3.1-PRMT5, pcDNA3.1-PRMT5 + G3BP2-WT or pcDNA3.1-PRMT5 + G3BP2-R468K, in PRMT5-knockout Tu686 cells. C , D The effect of G3BP2 inhibition or overexpression on lipogenesis was determined by Oil Red O staining in Tu686 and PRMT5-knockout Tu686 cells. Quantification of lipid droplets were performed by Image J. Scale bar: 75 μm, 25 μm. E , F Representative images and quantification of G3BP2 or G3BP2R468K with or without PRMT5 on lipogenesis by Oil Red O staining in PRMT5-knockout cells. Scale bar: 75 μm. PRMT5i for PRMT5 inhibitor. The data are presented as the mean ± SD; ns no significant difference, * P < 0.05; ** P < 0.01,*** P < 0.001.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Transfection, Knock-Out, Inhibition, Over Expression, Staining

A , C Cell viability was analyzed by Cell counting kit-8 (CCK-8). B , D Colony formation assays were performed to evaluate the proliferation ability of the cells with indicated treatments. Cells were seeded into six-well plates at a density of 1000 cells/well, and cultured for 12 d, and then stained with crystal violet. The colonies were captured and counted. E Transwell migration and invasion assays were used to estimate the migration and invasion ability of G3BP2-WT and G3BP2-R468K with or without PRMT5 expression. Representative pictures are shown on the left, and quantifications on the right. Scale bar: 100 μm. F Representative pictures shown the wound healing assays of G3BP2-WT and G3BP2-R468K with or without PRMT5 expression. Scale bar: 100 μm. G Immunoblotting analysis validated the protein expression levels of EMT and lipid metabolic-related markers. H Representative images of tumor-bearing nude mice. Tu686 cells were treated as indicated, such as EV, shG3BP2, shUSP7, and G3BP1 + shUSP7, and then injected into nude mice ( n = 5). I Tumor diameters were measured every 3 days, and tumor volumes were calculated. J Average tumor weight of the xenografts in each group were weighed. K Representative images of tumor-bearing nude mice. G3BP2-WT and G3BP2-R468K overexpression Tu686 cells with shPRMT5 were respectively injected into nude mice ( n = 5). L , M Tumor diameters and tumor volumes were calculated. N The levels of proliferation marker of Ki-67 were examined in different groups of tissues. Scar bar: 200 μm; 50 μm. O The H score of Ki-67 in different groups. P Representative images of Oil red O staining of tumor tissues from nude mice. scale bar: 100 μm; 25 μm. Q The quantification of the number of lipid droplets per cell among 200 cells in different groups. The data are presented as the mean ± SD * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A , C Cell viability was analyzed by Cell counting kit-8 (CCK-8). B , D Colony formation assays were performed to evaluate the proliferation ability of the cells with indicated treatments. Cells were seeded into six-well plates at a density of 1000 cells/well, and cultured for 12 d, and then stained with crystal violet. The colonies were captured and counted. E Transwell migration and invasion assays were used to estimate the migration and invasion ability of G3BP2-WT and G3BP2-R468K with or without PRMT5 expression. Representative pictures are shown on the left, and quantifications on the right. Scale bar: 100 μm. F Representative pictures shown the wound healing assays of G3BP2-WT and G3BP2-R468K with or without PRMT5 expression. Scale bar: 100 μm. G Immunoblotting analysis validated the protein expression levels of EMT and lipid metabolic-related markers. H Representative images of tumor-bearing nude mice. Tu686 cells were treated as indicated, such as EV, shG3BP2, shUSP7, and G3BP1 + shUSP7, and then injected into nude mice ( n = 5). I Tumor diameters were measured every 3 days, and tumor volumes were calculated. J Average tumor weight of the xenografts in each group were weighed. K Representative images of tumor-bearing nude mice. G3BP2-WT and G3BP2-R468K overexpression Tu686 cells with shPRMT5 were respectively injected into nude mice ( n = 5). L , M Tumor diameters and tumor volumes were calculated. N The levels of proliferation marker of Ki-67 were examined in different groups of tissues. Scar bar: 200 μm; 50 μm. O The H score of Ki-67 in different groups. P Representative images of Oil red O staining of tumor tissues from nude mice. scale bar: 100 μm; 25 μm. Q The quantification of the number of lipid droplets per cell among 200 cells in different groups. The data are presented as the mean ± SD * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Cell Counting, CCK-8 Assay, Cell Culture, Staining, Migration, Expressing, Western Blot, Injection, Over Expression, Marker

A Representative IHC images of methy-G3BP2, USP7, and PRMT5 proteins in HNSC tumor samples. Scale bar: 100 μm. Histogram shows the H score of methy-G3BP2 with PRMT5 ( B ) and USP7 ( C ), note that the scores of some samples overlapped. D IHC analysis estimate the expression of methy-G3BP2 in different tumor grade of HNSC. E Kaplan–Meier analyses of HNSC specimens survival stratified by the expression of methy-G3BP2. F mRNA expression of G3BP2 in HNSC tissues and normal tissues from the TCGA database. G Correlation between G3BP2 expression and tumor grade of HNSC patients in the TCGA cohort. H Pearson correlation coefficient between G3BP2, USP7, and PRMT5 in TCGA-HNSC cohort. I Immunoblotting analysis of indicated proteins expression level in HNSC and corresponding adjacent non-tumor tissues. J Representative images and quantification of the number of lipid droplets per cell among 200 cells of Oil red O staining in tumor and non-tumor tissues. ** P < 0.01, *** P < 0.001. K Proposed model to describe the role of G3BP2-R468 methylation on promoting USP7- and PRMT5-dependent lipogenesis and tumorigenesis.

Journal: Cell Death & Disease

Article Title: USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC

doi: 10.1038/s41419-023-05706-2

Figure Lengend Snippet: A Representative IHC images of methy-G3BP2, USP7, and PRMT5 proteins in HNSC tumor samples. Scale bar: 100 μm. Histogram shows the H score of methy-G3BP2 with PRMT5 ( B ) and USP7 ( C ), note that the scores of some samples overlapped. D IHC analysis estimate the expression of methy-G3BP2 in different tumor grade of HNSC. E Kaplan–Meier analyses of HNSC specimens survival stratified by the expression of methy-G3BP2. F mRNA expression of G3BP2 in HNSC tissues and normal tissues from the TCGA database. G Correlation between G3BP2 expression and tumor grade of HNSC patients in the TCGA cohort. H Pearson correlation coefficient between G3BP2, USP7, and PRMT5 in TCGA-HNSC cohort. I Immunoblotting analysis of indicated proteins expression level in HNSC and corresponding adjacent non-tumor tissues. J Representative images and quantification of the number of lipid droplets per cell among 200 cells of Oil red O staining in tumor and non-tumor tissues. ** P < 0.01, *** P < 0.001. K Proposed model to describe the role of G3BP2-R468 methylation on promoting USP7- and PRMT5-dependent lipogenesis and tumorigenesis.

Article Snippet: The sections were incubated with primary antibodies G3BP2 (16276-1-AP; Proteintech, 1:80), PRMT5 (79998, Cell Signaling Technology, 1:50) and Ki-67 (9027, Cell Signaling Technology, 1:800).

Techniques: Expressing, Western Blot, Staining, Methylation

PRMT5 potentiates STAT3 activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 potentiates STAT3 activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Activation Assay, Stable Transfection, Expressing, Control, Western Blot, Knockdown, Phospho-proteomics, Transfection, Inhibition, Methylation, Transduction

PRMT5 and MEP50 interact with Smad7. A) Smad7 interacts with PRMT5 and requires MEP50. HEK293T cells were transfected with HA‐PRMT5, FLAG‐Smad7, and MYC‐MEP50. Cell lysates were harvested and immunoprecipitated with HA antibody. The immunocomplexes and input were analyzed by using Western blotting analysis with indicated antibodies. B) Smad7 interacts with PRMT5 and MEP50 in vitro. Recombinant GST‐Smad7 or GST protein was produced and purified from Escherichia coli . MYC‐PRMT5 or G367A/R368A mutant together with MEP50 were expressed in HEK293T cells. In the GST pulldown assay, MYC‐PRMT5 or G367A/R368A proteins bound to GST proteins were retrieved with glutathione sepharose beads, and then analyzed by using Western blotting. C) PRMT5/MEP50 interacts with Smad7 in the MH2 domain. HEK293T cell transfection and Western blotting analysis were similarly done as described in Panel A. D) Smad7 interacts with endogenous PRMT5. Expression of SFB‐Smad7 was induced with or without 500 ng mL −1 Dox for 3 d in MCF10A‐tet‐on cells, and treated with 25 ng mL −1 IL‐6 for the indicated time. Cell lysates were harvested, precipitated with streptavidin beads, and analyzed by using Western blotting.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 and MEP50 interact with Smad7. A) Smad7 interacts with PRMT5 and requires MEP50. HEK293T cells were transfected with HA‐PRMT5, FLAG‐Smad7, and MYC‐MEP50. Cell lysates were harvested and immunoprecipitated with HA antibody. The immunocomplexes and input were analyzed by using Western blotting analysis with indicated antibodies. B) Smad7 interacts with PRMT5 and MEP50 in vitro. Recombinant GST‐Smad7 or GST protein was produced and purified from Escherichia coli . MYC‐PRMT5 or G367A/R368A mutant together with MEP50 were expressed in HEK293T cells. In the GST pulldown assay, MYC‐PRMT5 or G367A/R368A proteins bound to GST proteins were retrieved with glutathione sepharose beads, and then analyzed by using Western blotting. C) PRMT5/MEP50 interacts with Smad7 in the MH2 domain. HEK293T cell transfection and Western blotting analysis were similarly done as described in Panel A. D) Smad7 interacts with endogenous PRMT5. Expression of SFB‐Smad7 was induced with or without 500 ng mL −1 Dox for 3 d in MCF10A‐tet‐on cells, and treated with 25 ng mL −1 IL‐6 for the indicated time. Cell lysates were harvested, precipitated with streptavidin beads, and analyzed by using Western blotting.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Transfection, Immunoprecipitation, Western Blot, In Vitro, Recombinant, Produced, Purification, Mutagenesis, GST Pulldown Assay, Expressing

PRMT5 methylates Smad7 on R57. A) PRMT5 methylates Smad7. HEK293T cells were transfected with expression plasmids carrying MYC‐PRMT5/MEP50 and an SFB‐tagged construct, including gp130, JAK2, STAT3, Smad7, SHP2, and SOCS3. Cell lysates were harvested and precipitated with streptavidin beads. The retrieved complexes and input were analyzed by Western blotting with indicated antibodies. B) PRMT5 methylates the R57 residue on Smad7. HEK293T cells were transfected with MYC‐PRMT5/MEP50 and an SFB‐tagged Smad7 construct, i.e., wildtype Smad7 (WT) or a R‐to‐K substitution of Smad7 as indicated above the blots. Cell lysate was precipitated with streptavidin beads. Arginine di‐methylation of Smad7 was detected by Western blotting analysis. C) Mass spectrum of Smad7 Arg‐57 dimethylated peptide. Mass spectrometry identified Arg‐57 dimethylation of Smad7 in HEK293T cells expressing MYC‐PRMT5/MEP50 and SFB‐Smad7. Mass spectrometry profile of Smad7 sequence covering residue 47–64 is shown, and the dimethylated arginine side chains are indicated. D) PRMT5/MEP50 methylate Smad7, but not the R57K mutant. HEK293T cells were transfected MYC‐PRMT5/MEP50 and SFB‐Smad7 or Smad7 R57K mutant for 36 h. Cell lysates were harvested and immunoprecipitated with SYM10 antibody. The immunocomplexes and inputs were analyzed by Western blotting with indicated antibodies. E) PRMT5 methylates Smad7 in vitro. MYC‐PRMT5 or MYC‐G367A/R368A together with MYC‐MEP50 were immunopurified using anti‐MYC antibody from transfected HEK293T cells. Purified recombinant GST‐Smad7, GST‐Smad7 R57K mutant, and GST‐Smad4 were produced in E. coli . GST proteins and MYC‐PRMT5/MEP50 proteins were incubated in the presence of S‐adenosyl‐methionine to allow methylation reaction. Dimethylated Smad7 on R57 was detected by using Western blotting analysis.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 methylates Smad7 on R57. A) PRMT5 methylates Smad7. HEK293T cells were transfected with expression plasmids carrying MYC‐PRMT5/MEP50 and an SFB‐tagged construct, including gp130, JAK2, STAT3, Smad7, SHP2, and SOCS3. Cell lysates were harvested and precipitated with streptavidin beads. The retrieved complexes and input were analyzed by Western blotting with indicated antibodies. B) PRMT5 methylates the R57 residue on Smad7. HEK293T cells were transfected with MYC‐PRMT5/MEP50 and an SFB‐tagged Smad7 construct, i.e., wildtype Smad7 (WT) or a R‐to‐K substitution of Smad7 as indicated above the blots. Cell lysate was precipitated with streptavidin beads. Arginine di‐methylation of Smad7 was detected by Western blotting analysis. C) Mass spectrum of Smad7 Arg‐57 dimethylated peptide. Mass spectrometry identified Arg‐57 dimethylation of Smad7 in HEK293T cells expressing MYC‐PRMT5/MEP50 and SFB‐Smad7. Mass spectrometry profile of Smad7 sequence covering residue 47–64 is shown, and the dimethylated arginine side chains are indicated. D) PRMT5/MEP50 methylate Smad7, but not the R57K mutant. HEK293T cells were transfected MYC‐PRMT5/MEP50 and SFB‐Smad7 or Smad7 R57K mutant for 36 h. Cell lysates were harvested and immunoprecipitated with SYM10 antibody. The immunocomplexes and inputs were analyzed by Western blotting with indicated antibodies. E) PRMT5 methylates Smad7 in vitro. MYC‐PRMT5 or MYC‐G367A/R368A together with MYC‐MEP50 were immunopurified using anti‐MYC antibody from transfected HEK293T cells. Purified recombinant GST‐Smad7, GST‐Smad7 R57K mutant, and GST‐Smad4 were produced in E. coli . GST proteins and MYC‐PRMT5/MEP50 proteins were incubated in the presence of S‐adenosyl‐methionine to allow methylation reaction. Dimethylated Smad7 on R57 was detected by using Western blotting analysis.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Transfection, Expressing, Construct, Western Blot, Residue, Methylation, Mass Spectrometry, Sequencing, Mutagenesis, Immunoprecipitation, In Vitro, Purification, Recombinant, Produced, Incubation

Arg methylation enhances Smad7 binding to gp130. A) Smad7 methylation increases its association with gp130. HEK293T cells were transfected with SFB‐Smad7 or Smad7 R57K mutant and HA‐gp130, together with MYC‐PRMT5/MEP50. Cell lysates were harvested and immunoprecipitated with Streptavidin beads. Western blotting analysis was done with appropriate antibodies. B) PRMT5 depletion blocks Smad7 methylation and its interaction with endogenous gp130. A549 tet‐on cells expressing SFB‐Smad7 were cultured with or without 1 µg mL −1 Dox for 3 d and then transfected with 40 × 10 −12 m siPRMT5. Cell lysates were harvested and immunoprecipitated with streptavidin beads. Endogenous gp130 was detected from the immunoprecipitates by using Western blotting analysis. C) Methylated Smad7 binds more tightly to gp130. HEK293T cells were transfected with indicated expression plasmids for MYC‐PRMT5, MYC‐G367A/R368A, and MYC‐MEP50 as well as SFB‐Smad7 or SFB‐R57K. Dimethylated Smad7 was immunopurified using SYM10 antibody, while total Smad7 was retrieved using an‐FLAG antibody. Bacterially expressed GST‐gp130‐ICD was purified using glutathione‐sepharose and eluted with elution buffer (10 × 10 −3 m glutathione, pH 8.0). In the in vitro binding experiments for evaluating the Smad7‐gp130 interaction, recombinant GST‐gp130‐ICD was added to the immunopurified Smad7. gp130‐ICD binding to immobilized Smad7 was analyzed by using Western blotting. D) Unmethylatable Smad7 R57K mutant loses its ability to potentiate STAT3 activation. MCF10A tet‐on cells stably expressing SFB‐Smad7 or Smad7 R57K were induced with 10 ng mL −1 Dox for 3 d, and treated with indicated concentrations of IL‐6. Cell lysates were collected and subject to Western blotting analysis.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: Arg methylation enhances Smad7 binding to gp130. A) Smad7 methylation increases its association with gp130. HEK293T cells were transfected with SFB‐Smad7 or Smad7 R57K mutant and HA‐gp130, together with MYC‐PRMT5/MEP50. Cell lysates were harvested and immunoprecipitated with Streptavidin beads. Western blotting analysis was done with appropriate antibodies. B) PRMT5 depletion blocks Smad7 methylation and its interaction with endogenous gp130. A549 tet‐on cells expressing SFB‐Smad7 were cultured with or without 1 µg mL −1 Dox for 3 d and then transfected with 40 × 10 −12 m siPRMT5. Cell lysates were harvested and immunoprecipitated with streptavidin beads. Endogenous gp130 was detected from the immunoprecipitates by using Western blotting analysis. C) Methylated Smad7 binds more tightly to gp130. HEK293T cells were transfected with indicated expression plasmids for MYC‐PRMT5, MYC‐G367A/R368A, and MYC‐MEP50 as well as SFB‐Smad7 or SFB‐R57K. Dimethylated Smad7 was immunopurified using SYM10 antibody, while total Smad7 was retrieved using an‐FLAG antibody. Bacterially expressed GST‐gp130‐ICD was purified using glutathione‐sepharose and eluted with elution buffer (10 × 10 −3 m glutathione, pH 8.0). In the in vitro binding experiments for evaluating the Smad7‐gp130 interaction, recombinant GST‐gp130‐ICD was added to the immunopurified Smad7. gp130‐ICD binding to immobilized Smad7 was analyzed by using Western blotting. D) Unmethylatable Smad7 R57K mutant loses its ability to potentiate STAT3 activation. MCF10A tet‐on cells stably expressing SFB‐Smad7 or Smad7 R57K were induced with 10 ng mL −1 Dox for 3 d, and treated with indicated concentrations of IL‐6. Cell lysates were collected and subject to Western blotting analysis.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Methylation, Binding Assay, Transfection, Mutagenesis, Immunoprecipitation, Western Blot, Expressing, Cell Culture, Purification, In Vitro, Recombinant, Activation Assay, Stable Transfection

PRMT5 promotes STAT3 transcriptional and growth‐promoting responses. A) PRMT5 inhibition attenuates CDC25C expression in A549 cells. EPZ015666 or GSK591 (20 × 10 −6 m ) were added to A549 cells for 48 h. Cell lysates were harvested and analyzed by using qRT‐PCR to examine CDC25C mRNA levels. Data are shown as mean ± SD; n = 3. *** P < 0.001. B) PRMT5 inhibition attenuates CCNB1 expression in A549 cells. Cell treatment, harvest, and qRT‐PCR analysis were done as described in Panel A. Data are shown as mean ± SD; n = 3. *** P < 0.001. C) PRMT5 deficiency disables IL‐6/STAT3 responsiveness. GSEA showed that downregulated genes in PRMT5‐depleted A549 cells (shPRMT5‐2) were highly enriched in the IL‐6/STAT3 signaling gene set. Red, upregulated genes; blue, downregulated genes. NES = ‐1.73, FDR q value = 0.002. D) Heatmap showing expression levels (log 2 FPKM; left) and relative expression changes (log 2 (shPRMT5‐2/shCtrl); right) of the IL‐6/STAT3 signaling genes. E) Depletion of PRMT5 reduces DNA synthesis. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were subject to EdU staining to determine DNA incorporating rate (RiboBio),20x. F) Statistic analysis of the result in panel E. Data are shown as mean ± SD; n = 3. 0.01 < * P < 0.05. G) Inhibition of PRMT5 attenuates invasiveness in A549 cells. A549 cells were treated with PRMT5 inhibitors EPZ015666 or GSK591 (20 × 10 −6 m ) for 2 d, starved overnight in FBS‐free medium. 1 × 10 5 cells were plated in a transwell chamber and stained with crystal violet after 12 h. Purple color indicates crystal violet staining of the invaded cell population. H) PRMT5 depletion blocks colony formation. A549 stable cells were subject to crystal violet staining and photography.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 promotes STAT3 transcriptional and growth‐promoting responses. A) PRMT5 inhibition attenuates CDC25C expression in A549 cells. EPZ015666 or GSK591 (20 × 10 −6 m ) were added to A549 cells for 48 h. Cell lysates were harvested and analyzed by using qRT‐PCR to examine CDC25C mRNA levels. Data are shown as mean ± SD; n = 3. *** P < 0.001. B) PRMT5 inhibition attenuates CCNB1 expression in A549 cells. Cell treatment, harvest, and qRT‐PCR analysis were done as described in Panel A. Data are shown as mean ± SD; n = 3. *** P < 0.001. C) PRMT5 deficiency disables IL‐6/STAT3 responsiveness. GSEA showed that downregulated genes in PRMT5‐depleted A549 cells (shPRMT5‐2) were highly enriched in the IL‐6/STAT3 signaling gene set. Red, upregulated genes; blue, downregulated genes. NES = ‐1.73, FDR q value = 0.002. D) Heatmap showing expression levels (log 2 FPKM; left) and relative expression changes (log 2 (shPRMT5‐2/shCtrl); right) of the IL‐6/STAT3 signaling genes. E) Depletion of PRMT5 reduces DNA synthesis. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were subject to EdU staining to determine DNA incorporating rate (RiboBio),20x. F) Statistic analysis of the result in panel E. Data are shown as mean ± SD; n = 3. 0.01 < * P < 0.05. G) Inhibition of PRMT5 attenuates invasiveness in A549 cells. A549 cells were treated with PRMT5 inhibitors EPZ015666 or GSK591 (20 × 10 −6 m ) for 2 d, starved overnight in FBS‐free medium. 1 × 10 5 cells were plated in a transwell chamber and stained with crystal violet after 12 h. Purple color indicates crystal violet staining of the invaded cell population. H) PRMT5 depletion blocks colony formation. A549 stable cells were subject to crystal violet staining and photography.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Inhibition, Expressing, Quantitative RT-PCR, DNA Synthesis, Stable Transfection, Control, Staining

PRMT5 promotes lung tumorigenesis. A) Depletion of PRMT5 attenuates tumorigenesis. LLC cells stably expressing shControl or mouse sh‐mPRMT5‐1 or sh‐mPRMT5‐2 were subcutaneously injected into female nude mice. Ten days after implantation, tumors were dissected and photographed. B) Measurement of tumor weight in Panel A. Data are shown as mean ± SD; n = 5 for each group. 0.01 < * P < 0.05. C) PRMT5 depletion impairs STAT3 signaling in tumors. Tumor samples were analyzed by Western blotting to examine phosphorylated STAT3 (p‐STAT3) and STAT3 target gene products such as c‐Myc and Survivin. D) PRMT5 is highly expressed in nonsmall cell lung cancer tissues (NSCLC). NSCLC tissue microarray (Alenabio) was subject to immunohistochemistry (Servicebio) using PRMT5 antibody. E) Statistic analysis of IHC score in Panel D. Statistical analysis was performed using a two‐tailed Student's t ‐test. Data are shown as mean ± SD. Lung cancer samples = 45. Normal lung tissue samples = 55. *** P < 0.001. F) A working model for PRMT5‐mediated STAT3 activation.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 promotes lung tumorigenesis. A) Depletion of PRMT5 attenuates tumorigenesis. LLC cells stably expressing shControl or mouse sh‐mPRMT5‐1 or sh‐mPRMT5‐2 were subcutaneously injected into female nude mice. Ten days after implantation, tumors were dissected and photographed. B) Measurement of tumor weight in Panel A. Data are shown as mean ± SD; n = 5 for each group. 0.01 < * P < 0.05. C) PRMT5 depletion impairs STAT3 signaling in tumors. Tumor samples were analyzed by Western blotting to examine phosphorylated STAT3 (p‐STAT3) and STAT3 target gene products such as c‐Myc and Survivin. D) PRMT5 is highly expressed in nonsmall cell lung cancer tissues (NSCLC). NSCLC tissue microarray (Alenabio) was subject to immunohistochemistry (Servicebio) using PRMT5 antibody. E) Statistic analysis of IHC score in Panel D. Statistical analysis was performed using a two‐tailed Student's t ‐test. Data are shown as mean ± SD. Lung cancer samples = 45. Normal lung tissue samples = 55. *** P < 0.001. F) A working model for PRMT5‐mediated STAT3 activation.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Stable Transfection, Expressing, Injection, Western Blot, Microarray, Immunohistochemistry, Two Tailed Test, Activation Assay

Fig. 1. PRMT5 is upregulated during osteoclast differentiation, and PRMT5 knockdown inhibits osteoclast differentiation. (A) BMMs were cultured in the presence of M-CSF (30 ng/mL) and RANKL (100 ng/mL) and were collected at the indicated time points to analyze PRMT5 and c-fos protein expression. (B–C) PRMT5 protein expression in BMMs cells was assessed by western blotting. GAPDH was used as a loading control. Band densities were quantified and normalized to the control. Data are presented as mean ± SD of three independent experiments. *P b 0.05. (D–E) BMMs were seeded in 96-well plates at a density of 1.5 × 104 cells per well, transfected with PRMT5 siRNA and cultured in the presence of RANKL (100 ng/mL) and M-CSF (30 ng/mL) for 5 days. TRAP staining was performed, and TRAP-positive cells with three or more nuclei were counted using a microscope. Data are presented as mean ± SD of three independent experiments. *P b 0.05, **P b 0.01 versus vehicle.

Journal: Cellular signalling

Article Title: Inhibition of PRMT5 suppresses osteoclast differentiation and partially protects against ovariectomy-induced bone loss through downregulation of CXCL10 and RSAD2.

doi: 10.1016/j.cellsig.2017.03.004

Figure Lengend Snippet: Fig. 1. PRMT5 is upregulated during osteoclast differentiation, and PRMT5 knockdown inhibits osteoclast differentiation. (A) BMMs were cultured in the presence of M-CSF (30 ng/mL) and RANKL (100 ng/mL) and were collected at the indicated time points to analyze PRMT5 and c-fos protein expression. (B–C) PRMT5 protein expression in BMMs cells was assessed by western blotting. GAPDH was used as a loading control. Band densities were quantified and normalized to the control. Data are presented as mean ± SD of three independent experiments. *P b 0.05. (D–E) BMMs were seeded in 96-well plates at a density of 1.5 × 104 cells per well, transfected with PRMT5 siRNA and cultured in the presence of RANKL (100 ng/mL) and M-CSF (30 ng/mL) for 5 days. TRAP staining was performed, and TRAP-positive cells with three or more nuclei were counted using a microscope. Data are presented as mean ± SD of three independent experiments. *P b 0.05, **P b 0.01 versus vehicle.

Article Snippet: The PRMT5 inhibitor EPZ015666 (EPZ) was obtained from Selleck Chemicals (Houston, TX, USA).

Techniques: Knockdown, Cell Culture, Expressing, Western Blot, Control, Transfection, Staining, Microscopy

Fig. 8. EPZ inhibits osteoclastogenesis partially through downregulation of CXCL10 and RSAD2. (A) BMMs were treated with the indicated concentrations of EPZ in the presence of 100 ng/mL RANKL and 30 ng/mL M-CSF for 2 or 4 days. The medium was collected, and the CXCL10 protein level was assessed by ELISA. Data are presented as mean ± SD of three independent experiments. (B–C) BMMs were incubated with RANKL (100 ng/mL) and M-CSF (30 ng/mL), and then treated with EPZ (10 μM) and CXCL10 (10 ng/mL). Five days later, cells were fixed for TRAP staining. Representative images are shown, and TRAP-positive multinucleated osteoclasts (≥3 nuclei) were counted. (D, E) BMMs were treated with EPZ (10 μM) in the presence of M-CSF for 3 days. Expression of PRMT5 and RSAD2 protein was assessed by western blotting. GAPDH was used as a loading control. Band densities were quantified and normalized to the control. Data are presented as mean ± SD of three independent experiments. (F, G) BMMs were seeded in 96-well plates at a density of 1.5 × 104

Journal: Cellular signalling

Article Title: Inhibition of PRMT5 suppresses osteoclast differentiation and partially protects against ovariectomy-induced bone loss through downregulation of CXCL10 and RSAD2.

doi: 10.1016/j.cellsig.2017.03.004

Figure Lengend Snippet: Fig. 8. EPZ inhibits osteoclastogenesis partially through downregulation of CXCL10 and RSAD2. (A) BMMs were treated with the indicated concentrations of EPZ in the presence of 100 ng/mL RANKL and 30 ng/mL M-CSF for 2 or 4 days. The medium was collected, and the CXCL10 protein level was assessed by ELISA. Data are presented as mean ± SD of three independent experiments. (B–C) BMMs were incubated with RANKL (100 ng/mL) and M-CSF (30 ng/mL), and then treated with EPZ (10 μM) and CXCL10 (10 ng/mL). Five days later, cells were fixed for TRAP staining. Representative images are shown, and TRAP-positive multinucleated osteoclasts (≥3 nuclei) were counted. (D, E) BMMs were treated with EPZ (10 μM) in the presence of M-CSF for 3 days. Expression of PRMT5 and RSAD2 protein was assessed by western blotting. GAPDH was used as a loading control. Band densities were quantified and normalized to the control. Data are presented as mean ± SD of three independent experiments. (F, G) BMMs were seeded in 96-well plates at a density of 1.5 × 104

Article Snippet: The PRMT5 inhibitor EPZ015666 (EPZ) was obtained from Selleck Chemicals (Houston, TX, USA).

Techniques: Enzyme-linked Immunosorbent Assay, Incubation, Staining, Expressing, Western Blot, Control

Summary of  PRMT5  scoring distribution

Journal: Journal of Translational Medicine

Article Title: Targeting protein arginine methyltransferase 5 inhibits human hepatocellular carcinoma growth via the downregulation of beta-catenin

doi: 10.1186/s12967-015-0721-8

Figure Lengend Snippet: Summary of PRMT5 scoring distribution

Article Snippet: After being blocked with 5 % non-fat milk for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight: PRMT5 (1:400; Santa Cruz Biotech, Santa Cruz, CA, USA), PRMT7 (1:500; Santa Cruz Biotech), Cyclin D1 (1:500; Santa Cruz Biotech), CTNNB1 (β-catenin, 1:1000; ABclonal, MA, USA), H4R3me2s (1:2000; Abcam, MA, USA), H3R8me2s (1:250; Novus, CO, USA), Bax (1:1000; Cell Signaling, MA, USA), Bcl-2 (1:1000; Cell Signaling), PRMT7 (1:1000; Cell Signaling) or β-actin (1:2000; Cell Signaling), and then incubated with secondary antibodies conjugated to horseradish peroxidase (ZSGB-BIO, Beijing, China).

Techniques:

Univariate and multivariate analyses of the survival of HCC patients

Journal: Journal of Translational Medicine

Article Title: Targeting protein arginine methyltransferase 5 inhibits human hepatocellular carcinoma growth via the downregulation of beta-catenin

doi: 10.1186/s12967-015-0721-8

Figure Lengend Snippet: Univariate and multivariate analyses of the survival of HCC patients

Article Snippet: After being blocked with 5 % non-fat milk for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight: PRMT5 (1:400; Santa Cruz Biotech, Santa Cruz, CA, USA), PRMT7 (1:500; Santa Cruz Biotech), Cyclin D1 (1:500; Santa Cruz Biotech), CTNNB1 (β-catenin, 1:1000; ABclonal, MA, USA), H4R3me2s (1:2000; Abcam, MA, USA), H3R8me2s (1:250; Novus, CO, USA), Bax (1:1000; Cell Signaling, MA, USA), Bcl-2 (1:1000; Cell Signaling), PRMT7 (1:1000; Cell Signaling) or β-actin (1:2000; Cell Signaling), and then incubated with secondary antibodies conjugated to horseradish peroxidase (ZSGB-BIO, Beijing, China).

Techniques:

Silencing PRMT5 decreases human HCC cell growth in vitro. a HepG2 and Bel-7404 cells were transfected with PRMT5 siRNA (si-PRMT5) or scramble negative control siRNA (si-NC) and cell proliferation was analyzed. b Normal liver HL-7702 cells were transfected with PRMT5 siRNA (si-PRMT5) or scramble negative control siRNA (si-NC) and cell proliferation was analyzed. c The effect of si-PRMT5 on colony formation of HepG2 and HL-7702 cells. Representative results of colony formation of vehicle ( left ), si-NC ( middle ), and si-PRMT5 ( right ) HepG2 and HL-7702 cells. 5-fluorouracil (5-Fu) is used as a positive control. d Knockdown of PRMT5 led to G1 arrest. HepG2 cells were transfected with si-NC or si-PRMT5 and then subjected to cell cycle analysis. e and f Western blot analysis of whole-cell lysates derived from HepG2 cells transfected with si-NC or si-PRMT5 using antibodies against PRMT5, β-catenin, Cyclin D1, H4R3me2s or H3R8me2s

Journal: Journal of Translational Medicine

Article Title: Targeting protein arginine methyltransferase 5 inhibits human hepatocellular carcinoma growth via the downregulation of beta-catenin

doi: 10.1186/s12967-015-0721-8

Figure Lengend Snippet: Silencing PRMT5 decreases human HCC cell growth in vitro. a HepG2 and Bel-7404 cells were transfected with PRMT5 siRNA (si-PRMT5) or scramble negative control siRNA (si-NC) and cell proliferation was analyzed. b Normal liver HL-7702 cells were transfected with PRMT5 siRNA (si-PRMT5) or scramble negative control siRNA (si-NC) and cell proliferation was analyzed. c The effect of si-PRMT5 on colony formation of HepG2 and HL-7702 cells. Representative results of colony formation of vehicle ( left ), si-NC ( middle ), and si-PRMT5 ( right ) HepG2 and HL-7702 cells. 5-fluorouracil (5-Fu) is used as a positive control. d Knockdown of PRMT5 led to G1 arrest. HepG2 cells were transfected with si-NC or si-PRMT5 and then subjected to cell cycle analysis. e and f Western blot analysis of whole-cell lysates derived from HepG2 cells transfected with si-NC or si-PRMT5 using antibodies against PRMT5, β-catenin, Cyclin D1, H4R3me2s or H3R8me2s

Article Snippet: After being blocked with 5 % non-fat milk for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight: PRMT5 (1:400; Santa Cruz Biotech, Santa Cruz, CA, USA), PRMT7 (1:500; Santa Cruz Biotech), Cyclin D1 (1:500; Santa Cruz Biotech), CTNNB1 (β-catenin, 1:1000; ABclonal, MA, USA), H4R3me2s (1:2000; Abcam, MA, USA), H3R8me2s (1:250; Novus, CO, USA), Bax (1:1000; Cell Signaling, MA, USA), Bcl-2 (1:1000; Cell Signaling), PRMT7 (1:1000; Cell Signaling) or β-actin (1:2000; Cell Signaling), and then incubated with secondary antibodies conjugated to horseradish peroxidase (ZSGB-BIO, Beijing, China).

Techniques: In Vitro, Transfection, Negative Control, Positive Control, Knockdown, Cell Cycle Assay, Western Blot, Derivative Assay

Clinical and pathological characteristics of patients with HCC (n = 54)

Journal: Journal of Translational Medicine

Article Title: Targeting protein arginine methyltransferase 5 inhibits human hepatocellular carcinoma growth via the downregulation of beta-catenin

doi: 10.1186/s12967-015-0721-8

Figure Lengend Snippet: Clinical and pathological characteristics of patients with HCC (n = 54)

Article Snippet: After being blocked with 5 % non-fat milk for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight: PRMT5 (1:400; Santa Cruz Biotech, Santa Cruz, CA, USA), PRMT7 (1:500; Santa Cruz Biotech), Cyclin D1 (1:500; Santa Cruz Biotech), CTNNB1 (β-catenin, 1:1000; ABclonal, MA, USA), H4R3me2s (1:2000; Abcam, MA, USA), H3R8me2s (1:250; Novus, CO, USA), Bax (1:1000; Cell Signaling, MA, USA), Bcl-2 (1:1000; Cell Signaling), PRMT7 (1:1000; Cell Signaling) or β-actin (1:2000; Cell Signaling), and then incubated with secondary antibodies conjugated to horseradish peroxidase (ZSGB-BIO, Beijing, China).

Techniques:

ULK1 interacts directly with the PRMT5 complex independent of its role in autophagy. ( A ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by 1 h of starvation treatment with EBSS. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, PRMT5, WD45, and pICln. ( B ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by treatment with full or starvation medium (EBSS) in the absence or presence of bafilomycin A1 (BafA1; 10 nM) for 1 h. Afterward, cells were harvested, lysed, and cleared cellular lysates were subjected to Tris/Glycine-SDS-PAGE and immunoblotting for GFP, ULK1 pS757, ATG14, ATG14 pS29, p62, LC3, GAPDH, and Actin. ( C ) Flp-In T-REx 293-GFP-ULK1, -GFP-ULK1/ΔCTD and -GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against FIP200, GFP, PRMT5, ATG13, WD45, pICln and ATG101. ( D ) HEK293T cells were stably transfected with pMSCVbsd-GFP-ULK1 kinase domain (k. dom.) and pMSCVbsd-GFP constructs. Additionally, HEK293T cells were transiently transfected with pcDNA5-FRT-TO-GFP-ULK1 GABARAP domain (GABARAP dom.) and -ULK1 C-terminal domain (CTD) constructs. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, FIP200, ATG13, ATG101, PRMT5, WD45, and pICln. ( E ) S100 extract was generated of HEK293T cells and applied to a Superdex 200 increase column. Fractions were analyzed by Tris/Glycine-SDS-PAGE and immunoblotting using antibodies against ULK1, ATG13, ATG101, PRMT5, WD45 and pICln. ( F ) S100 extract of HEK293T cells was applied to a Superdex 200 increase column and subsequent immunoprecipitation of endogenous was performed with antibody against ULK1. Immunoprecipitation was analyzed by Tris/Glycine-SDS-PAGE using antibodies against ULK1 and pICln.

Journal: Nucleic Acids Research

Article Title: An essential role of the autophagy activating kinase ULK1 in snRNP biogenesis

doi: 10.1093/nar/gkab452

Figure Lengend Snippet: ULK1 interacts directly with the PRMT5 complex independent of its role in autophagy. ( A ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by 1 h of starvation treatment with EBSS. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, PRMT5, WD45, and pICln. ( B ) Flp-In T-REx 293-GFP-ULK1 and Flp-In T-REx 293-GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h, followed by treatment with full or starvation medium (EBSS) in the absence or presence of bafilomycin A1 (BafA1; 10 nM) for 1 h. Afterward, cells were harvested, lysed, and cleared cellular lysates were subjected to Tris/Glycine-SDS-PAGE and immunoblotting for GFP, ULK1 pS757, ATG14, ATG14 pS29, p62, LC3, GAPDH, and Actin. ( C ) Flp-In T-REx 293-GFP-ULK1, -GFP-ULK1/ΔCTD and -GFP cells were stimulated with 0.1 μg/ml doxycycline for 18 h. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against FIP200, GFP, PRMT5, ATG13, WD45, pICln and ATG101. ( D ) HEK293T cells were stably transfected with pMSCVbsd-GFP-ULK1 kinase domain (k. dom.) and pMSCVbsd-GFP constructs. Additionally, HEK293T cells were transiently transfected with pcDNA5-FRT-TO-GFP-ULK1 GABARAP domain (GABARAP dom.) and -ULK1 C-terminal domain (CTD) constructs. After cytoplasm extraction (S100) GFP-IP was performed and analyzed by Tris/Glycine-SDS-PAGE and western blotting using antibodies against GFP, FIP200, ATG13, ATG101, PRMT5, WD45, and pICln. ( E ) S100 extract was generated of HEK293T cells and applied to a Superdex 200 increase column. Fractions were analyzed by Tris/Glycine-SDS-PAGE and immunoblotting using antibodies against ULK1, ATG13, ATG101, PRMT5, WD45 and pICln. ( F ) S100 extract of HEK293T cells was applied to a Superdex 200 increase column and subsequent immunoprecipitation of endogenous was performed with antibody against ULK1. Immunoprecipitation was analyzed by Tris/Glycine-SDS-PAGE using antibodies against ULK1 and pICln.

Article Snippet: The following primary antibodies were used for immunoblotting and immunofluorescence: α-Actin (A5316, Sigma Aldrich), α-ATG3 (3415, CST), α-ATG101 (SAB4200175, Sigma-Aldrich), α-ATG13 (M183-3, MBL; SAB4200100, Sigma-Aldrich), α-ATG14 (PD026, MBL), α-ATG14 pS29 (92340, CST), α-Coilin (PA5-29531, Invitrogen), α-FIP200 (A301-574A, Bethyl), α-GAPDH (ab8245, Abcam), α-GFP (3H9, Chromotek), α-LC3B (2775, CST), α-p62 (GP62-C, PROGEN), α-pICln (sc-393525, Santa Cruz), α-PRMT5 (2252, CST), α-SmB (S0698, Sigma-Aldrich), α-SmD1 (ab79977, Abcam), α-SmD2 (SAB2102257, Sigma-Aldrich), α-SmE (NBP2-43792, Novus), α-SmF (SAB2102258, Sigma-Aldrich), α-SmG (HPA064152, Sigma-Aldrich), α-SMN (clone 2B1, 05-1532, Merck Millipore), α-SNRPB (Y12, MA5-13449, Invitrogen), α-Tubulin (clone B512, T5168, Sigma Aldrich), α-ULK1 (8054; CST), α-ULK2 (ab97695, Abcam), α-WD45 (2823, CST).

Techniques: Extraction, SDS Page, Western Blot, Stable Transfection, Transfection, Construct, Generated, Immunoprecipitation

ULK1 phosphorylates pICln in the C-terminal region on residues S193, S195 and S197. ( A ) In vitro kinase assay using recombinant active GST-ULK1 expressed in Sf9 insect cells and GST-PRMT5, -WD45, and -pICln purified from E. coli as substrate proteins were incubated with 10 μCi [32P]-ATP for 45 min. at 30°C. Samples were separated by Tris/Glycine-SDS-PAGE and analyzed by autoradiography. ( B ) In vitro kinase assay with purified GFP-ULK1 or GFP-ULK1 kinase-dead mutant (GFP-ULK1kd) overexpressed in Flp-In T-REx 293 cells and GST-pICln was executed as described in (A). Amounts of the GFP precipitation from GFP-ULK1 and GFP-ULK1 kinase-dead were directly compared by Tris/Glycine-SDS-PAGE and Western-Blot analysis using antibodies against ULK1 and GFP. ( C ) In vitro kinase assay using recombinant active GST-ULK1 or -ULK2 expressed in Sf9 cells and GST-pICln was executed as described in (A). ( D , E ) Gel filtration was performed with HEK293T wild type (D) and HEK293T ULK1-siRNA knockdown (E) S100 extracts fractionated by a Superdex 200 column and evaluated by western blotting. Appropriate fractions were used for in vitro kinase assay using exogenous GST-pICln substrate protein and 10 μCi [32P]-ATP for 45 min. at 30°C and analyzed by autoradiography (Exposure time of 30 minutes for (D) and (E)). ( F ) Schematic view of pICln protein with its three acidic domains (AD1-3) and the ULK1-dependent phosphorylation sites. In vitro kinase assay was performed with recombinant active GST-ULK1 from Sf9 cells and GST-pICln as described in (A). After Tris/Glycine-SDS-PAGE and coomassie blue staining, the pICln band was excised and phosphorylation status was analyzed by mass spectrometry (LC-MS/MS). Three phosphosites were detected: S193 ( P = 3.05E-05, 94.5%), S195 ( P = 2.3E–07, 100%), S197 ( P = 2.8E–06, 100%). ( G ) Recombinant active GST-ULK1 from Sf9 insect cells was incubated with 1 μM ULK inhibitor MRT67307 for 30 min at 30°C. In vitro kinase assay with inhibitor-treated and non-treated GST-ULK1 was performed using substrate proteins GST-pICln wild type and alanine mutant purified from E. coli as described in (A). AR: autoradiography, CS: coomassie blue staining, WB: western blotting. See also .

Journal: Nucleic Acids Research

Article Title: An essential role of the autophagy activating kinase ULK1 in snRNP biogenesis

doi: 10.1093/nar/gkab452

Figure Lengend Snippet: ULK1 phosphorylates pICln in the C-terminal region on residues S193, S195 and S197. ( A ) In vitro kinase assay using recombinant active GST-ULK1 expressed in Sf9 insect cells and GST-PRMT5, -WD45, and -pICln purified from E. coli as substrate proteins were incubated with 10 μCi [32P]-ATP for 45 min. at 30°C. Samples were separated by Tris/Glycine-SDS-PAGE and analyzed by autoradiography. ( B ) In vitro kinase assay with purified GFP-ULK1 or GFP-ULK1 kinase-dead mutant (GFP-ULK1kd) overexpressed in Flp-In T-REx 293 cells and GST-pICln was executed as described in (A). Amounts of the GFP precipitation from GFP-ULK1 and GFP-ULK1 kinase-dead were directly compared by Tris/Glycine-SDS-PAGE and Western-Blot analysis using antibodies against ULK1 and GFP. ( C ) In vitro kinase assay using recombinant active GST-ULK1 or -ULK2 expressed in Sf9 cells and GST-pICln was executed as described in (A). ( D , E ) Gel filtration was performed with HEK293T wild type (D) and HEK293T ULK1-siRNA knockdown (E) S100 extracts fractionated by a Superdex 200 column and evaluated by western blotting. Appropriate fractions were used for in vitro kinase assay using exogenous GST-pICln substrate protein and 10 μCi [32P]-ATP for 45 min. at 30°C and analyzed by autoradiography (Exposure time of 30 minutes for (D) and (E)). ( F ) Schematic view of pICln protein with its three acidic domains (AD1-3) and the ULK1-dependent phosphorylation sites. In vitro kinase assay was performed with recombinant active GST-ULK1 from Sf9 cells and GST-pICln as described in (A). After Tris/Glycine-SDS-PAGE and coomassie blue staining, the pICln band was excised and phosphorylation status was analyzed by mass spectrometry (LC-MS/MS). Three phosphosites were detected: S193 ( P = 3.05E-05, 94.5%), S195 ( P = 2.3E–07, 100%), S197 ( P = 2.8E–06, 100%). ( G ) Recombinant active GST-ULK1 from Sf9 insect cells was incubated with 1 μM ULK inhibitor MRT67307 for 30 min at 30°C. In vitro kinase assay with inhibitor-treated and non-treated GST-ULK1 was performed using substrate proteins GST-pICln wild type and alanine mutant purified from E. coli as described in (A). AR: autoradiography, CS: coomassie blue staining, WB: western blotting. See also .

Article Snippet: The following primary antibodies were used for immunoblotting and immunofluorescence: α-Actin (A5316, Sigma Aldrich), α-ATG3 (3415, CST), α-ATG101 (SAB4200175, Sigma-Aldrich), α-ATG13 (M183-3, MBL; SAB4200100, Sigma-Aldrich), α-ATG14 (PD026, MBL), α-ATG14 pS29 (92340, CST), α-Coilin (PA5-29531, Invitrogen), α-FIP200 (A301-574A, Bethyl), α-GAPDH (ab8245, Abcam), α-GFP (3H9, Chromotek), α-LC3B (2775, CST), α-p62 (GP62-C, PROGEN), α-pICln (sc-393525, Santa Cruz), α-PRMT5 (2252, CST), α-SmB (S0698, Sigma-Aldrich), α-SmD1 (ab79977, Abcam), α-SmD2 (SAB2102257, Sigma-Aldrich), α-SmE (NBP2-43792, Novus), α-SmF (SAB2102258, Sigma-Aldrich), α-SmG (HPA064152, Sigma-Aldrich), α-SMN (clone 2B1, 05-1532, Merck Millipore), α-SNRPB (Y12, MA5-13449, Invitrogen), α-Tubulin (clone B512, T5168, Sigma Aldrich), α-ULK1 (8054; CST), α-ULK2 (ab97695, Abcam), α-WD45 (2823, CST).

Techniques: In Vitro, Kinase Assay, Recombinant, Purification, Incubation, SDS Page, Autoradiography, Mutagenesis, Western Blot, Filtration, Knockdown, Phospho-proteomics, Staining, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy

Cardiac-specific overexpression of PRMT5 accelerates pressure overload-induced cardiac systolic dysfunction. a A schematic diagram of the transgene to create mice with cardiac-specific Prmt5 overexpression (PRMT5-TG). b Images of WT and PRMT5-TG mice littermates at 10 weeks of age. Scale bar: 20 µm. c Cardiac PRMT5 overexpression confirmed using Western blotting. d Echocardiographic analysis images of PRMT5-TG mice performed 4 weeks after TAC surgery. e , f Fractional shorting ( e ) and ejection fraction ( f ) calculated from M-mode echocardiography. Values are presented as mean ± SD (n = 6–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. *** p < 0.001

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: Cardiac-specific overexpression of PRMT5 accelerates pressure overload-induced cardiac systolic dysfunction. a A schematic diagram of the transgene to create mice with cardiac-specific Prmt5 overexpression (PRMT5-TG). b Images of WT and PRMT5-TG mice littermates at 10 weeks of age. Scale bar: 20 µm. c Cardiac PRMT5 overexpression confirmed using Western blotting. d Echocardiographic analysis images of PRMT5-TG mice performed 4 weeks after TAC surgery. e , f Fractional shorting ( e ) and ejection fraction ( f ) calculated from M-mode echocardiography. Values are presented as mean ± SD (n = 6–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. *** p < 0.001

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Over Expression, Western Blot, Comparison

Cardiac overexpression of PRMT5 promotes pressure overload-induced cardiac hypertrophy. a Representative photos of the hearts extracted from the mice. b Histological analysis of the heart tissues. Scale bars: 2 mm. c Heart weight/body weight comparisons at 4 weeks after TAC surgery. Values are presented as mean ± SD (n = 6–8 mice/group) d Cardiac overexpression of PRMT5 promotes the increases in lung weight after TAC surgery. e , f Histological analysis results of PRMT5-TG mice at 4 weeks after TAC surgery. Representative images of HE-stained sections of the mice hearts. Cross-sectional myocardial cell diameter measurement ( e ). Representative images of MT-stained perivascular and interstitial fibrosis area of the LV myocardium of the mice. Perivascular and interstitial fibrotic area measurements ( f ). Values are presented as mean ± SD (n = 5 mice/group). Scale bars: 20 µm ( e ), 50 µm (Perivascular) and 100 µm (interstitial) ( f ). g Hypertrophic gene expression is increased by cardiac overexpression of PRMT5. Values are expressed as mean ± SD (n = 7–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. * p < 0.05, ** p < 0.01, *** p < 0.001

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: Cardiac overexpression of PRMT5 promotes pressure overload-induced cardiac hypertrophy. a Representative photos of the hearts extracted from the mice. b Histological analysis of the heart tissues. Scale bars: 2 mm. c Heart weight/body weight comparisons at 4 weeks after TAC surgery. Values are presented as mean ± SD (n = 6–8 mice/group) d Cardiac overexpression of PRMT5 promotes the increases in lung weight after TAC surgery. e , f Histological analysis results of PRMT5-TG mice at 4 weeks after TAC surgery. Representative images of HE-stained sections of the mice hearts. Cross-sectional myocardial cell diameter measurement ( e ). Representative images of MT-stained perivascular and interstitial fibrosis area of the LV myocardium of the mice. Perivascular and interstitial fibrotic area measurements ( f ). Values are presented as mean ± SD (n = 5 mice/group). Scale bars: 20 µm ( e ), 50 µm (Perivascular) and 100 µm (interstitial) ( f ). g Hypertrophic gene expression is increased by cardiac overexpression of PRMT5. Values are expressed as mean ± SD (n = 7–8 mice/group). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. A p < 0.05 is considered statistically significant. * p < 0.05, ** p < 0.01, *** p < 0.001

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Over Expression, Staining, Gene Expression, Comparison

Pharmacological inhibition and knockdown of PRMT5 suppresses phenylephrine (PE)-induced hypertrophic responses in cultured cardiomyocytes. a Immunostaining images for α-actinin to determine the cell surface area of cardiomyocytes, quantified using ImageJ software. Scale bars: 20 µm. b Hypertrophic gene expression levels of Nppa and Nppb , quantified by qRT-PCR. c Primary cultured cardiomyocytes were transfected with siRNA (siControl or siPrmt5) and then stimulated with or without PE (30 µM). Prmt5 knockdown is confirmed by qRT-PCR and WB. The cell surface area was quantified using ImageJ software. Scale bars: 20 µm. d PE-induced Nppa and Nppb gene expression as quantified by qRT-PCR and Western blotting. Values are presented as mean ± SD (n = 4–5). Data are analyzed using one-way ANOVA, followed by Dunnett’s multiple comparison tests versus the PE-treated group. * p < 0.05, ** p < 0.01, *** p < 0.001

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: Pharmacological inhibition and knockdown of PRMT5 suppresses phenylephrine (PE)-induced hypertrophic responses in cultured cardiomyocytes. a Immunostaining images for α-actinin to determine the cell surface area of cardiomyocytes, quantified using ImageJ software. Scale bars: 20 µm. b Hypertrophic gene expression levels of Nppa and Nppb , quantified by qRT-PCR. c Primary cultured cardiomyocytes were transfected with siRNA (siControl or siPrmt5) and then stimulated with or without PE (30 µM). Prmt5 knockdown is confirmed by qRT-PCR and WB. The cell surface area was quantified using ImageJ software. Scale bars: 20 µm. d PE-induced Nppa and Nppb gene expression as quantified by qRT-PCR and Western blotting. Values are presented as mean ± SD (n = 4–5). Data are analyzed using one-way ANOVA, followed by Dunnett’s multiple comparison tests versus the PE-treated group. * p < 0.05, ** p < 0.01, *** p < 0.001

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Inhibition, Knockdown, Cell Culture, Immunostaining, Software, Gene Expression, Quantitative RT-PCR, Transfection, Western Blot, Comparison

PRMT5 modifies histone methylation and acetylation in hearts and cultured cardiomyocytes. a Acid extracts from mouse hearts of WT and PRMT5 transgenic (PRMT5-TG) mice were applied to Western blotting analysis. Western blotting was performed using the indicated antibodies. b WT and PRMT5-TG mice were subjected to the TAC surgery. The samples prepared from these hearts were used for Western blotting. c Western blotting was performed using acid extracts from mouse hearts of sham and TAC mice treated with or without the PRMT5 inhibitor EPZ015666. Values are presented as mean ± SD (n = 4 mice). d Cultured cardiomyocytes were treated with EPZ015666 in the presence or absence of PE. Values are presented as mean ± SD (n = 3). e HAT activity in hearts was measured using a fluorescent-based method. A p300 HAT inhibitor, C646, was added to the protein extracts from the hearts of PRMT5-TG mice. Values are presented as mean ± SD (n = 10 mice/group). f Immunostaining images for α-actinin to determine the cell surface area of cardiomyocytes, quantified using ImageJ software. Scale bars: 20 µm. Values are presented as mean ± SD (n = 4). Data are analyzed using one-way ANOVA, followed by Tukey’s multiple comparison ( c , e , f ) or Dunnett’s multiple comparison tests versus the PE-treated group ( d ). * p < 0.05, ** p < 0.01, *** p < 0.001

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: PRMT5 modifies histone methylation and acetylation in hearts and cultured cardiomyocytes. a Acid extracts from mouse hearts of WT and PRMT5 transgenic (PRMT5-TG) mice were applied to Western blotting analysis. Western blotting was performed using the indicated antibodies. b WT and PRMT5-TG mice were subjected to the TAC surgery. The samples prepared from these hearts were used for Western blotting. c Western blotting was performed using acid extracts from mouse hearts of sham and TAC mice treated with or without the PRMT5 inhibitor EPZ015666. Values are presented as mean ± SD (n = 4 mice). d Cultured cardiomyocytes were treated with EPZ015666 in the presence or absence of PE. Values are presented as mean ± SD (n = 3). e HAT activity in hearts was measured using a fluorescent-based method. A p300 HAT inhibitor, C646, was added to the protein extracts from the hearts of PRMT5-TG mice. Values are presented as mean ± SD (n = 10 mice/group). f Immunostaining images for α-actinin to determine the cell surface area of cardiomyocytes, quantified using ImageJ software. Scale bars: 20 µm. Values are presented as mean ± SD (n = 4). Data are analyzed using one-way ANOVA, followed by Tukey’s multiple comparison ( c , e , f ) or Dunnett’s multiple comparison tests versus the PE-treated group ( d ). * p < 0.05, ** p < 0.01, *** p < 0.001

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Methylation, Cell Culture, Transgenic Assay, Western Blot, Activity Assay, Immunostaining, Software, Comparison

PRMT5 methylates p300 at R200. a The plasmids of WT PRMT5 and the deletion mutant lacking enzymatic activity of PRMT5 (ΔPRMT5) were transfected into HEK293T cells. Immunoprecipitation of p300 and Western blotting was performed. b GST pull-down assay was performed with GST-fusioned aa1-450, aa1514-1922, and aa1817-2160 of p300 mutants extracted from E. coli . [ 35 S]radiolabeled PRMT5 was obtained using an in vitro translation system. The arrows show GST fusion proteins. c PRMT5 and aa1-450, aa1514-1922, and aa1817-2160 of p300 mutants were mixed in reaction solution with [ 14 C]radiolabeled S-adenosyl methionine (SAM). The proteins were analyzed using SDS-PAGE and scanned using BAS2000. d PRMT5 and R200K, R202K, and R237K of p300 aa1-450 point mutants were mixed in reaction solution with [ 14 C]radiolabeled SAM, and an in vitro methylation assay was performed

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: PRMT5 methylates p300 at R200. a The plasmids of WT PRMT5 and the deletion mutant lacking enzymatic activity of PRMT5 (ΔPRMT5) were transfected into HEK293T cells. Immunoprecipitation of p300 and Western blotting was performed. b GST pull-down assay was performed with GST-fusioned aa1-450, aa1514-1922, and aa1817-2160 of p300 mutants extracted from E. coli . [ 35 S]radiolabeled PRMT5 was obtained using an in vitro translation system. The arrows show GST fusion proteins. c PRMT5 and aa1-450, aa1514-1922, and aa1817-2160 of p300 mutants were mixed in reaction solution with [ 14 C]radiolabeled S-adenosyl methionine (SAM). The proteins were analyzed using SDS-PAGE and scanned using BAS2000. d PRMT5 and R200K, R202K, and R237K of p300 aa1-450 point mutants were mixed in reaction solution with [ 14 C]radiolabeled SAM, and an in vitro methylation assay was performed

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Mutagenesis, Activity Assay, Transfection, Immunoprecipitation, Western Blot, Pull Down Assay, In Vitro, SDS Page, Methylation

PRMT5-mediated p300 arginine methylation of R200 is required for p300 histone acetyltransferase activity. a The plasmids encoding p300 WT or p300 R200K point mutant and PRMT5 were transfected to HEK293T cells. Immunoprecipitation by anti-HA antibody followed by Western blotting was performed. The band density was measured using ImageJ software. Values are presented as mean ± SD (n = 3). b p300 WT and p300 R200K point mutant were purified using anti-HA-tag agarose beads from HEK293T cells co-transfected with or without PRMT5. Purified p300 was incubated with recombinant histone H3 peptide and [ 3 H]-labeled acetyl-CoA. The histone H3 peptides were isolated, and radioactivity was measured using a liquid scintillation counter. Values are presented as mean ± SD (n = 6). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. p < 0.05 was considered statistically significant. * p < 0.05, *** p < 0.001

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: PRMT5-mediated p300 arginine methylation of R200 is required for p300 histone acetyltransferase activity. a The plasmids encoding p300 WT or p300 R200K point mutant and PRMT5 were transfected to HEK293T cells. Immunoprecipitation by anti-HA antibody followed by Western blotting was performed. The band density was measured using ImageJ software. Values are presented as mean ± SD (n = 3). b p300 WT and p300 R200K point mutant were purified using anti-HA-tag agarose beads from HEK293T cells co-transfected with or without PRMT5. Purified p300 was incubated with recombinant histone H3 peptide and [ 3 H]-labeled acetyl-CoA. The histone H3 peptides were isolated, and radioactivity was measured using a liquid scintillation counter. Values are presented as mean ± SD (n = 6). Data are analyzed using two-way ANOVA, followed by Tukey’s multiple comparison test. p < 0.05 was considered statistically significant. * p < 0.05, *** p < 0.001

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Methylation, Activity Assay, Mutagenesis, Transfection, Immunoprecipitation, Western Blot, Software, Purification, Incubation, Recombinant, Labeling, Isolation, Radioactivity, Comparison

Graphical abstract. The gain-of-function of PRMT5 accelerates pressure overload-induced cardiomyocyte hypertrophy and heart failure. PRMT5 methylates p300 at R200 and regulates p300 HAT activity, which is essential for histone acetylation during the development of cardiomyocyte hypertrophy

Journal: Journal of Biomedical Science

Article Title: Cardiac-specific overexpression of PRMT5 exacerbates pressure overload-induced hypertrophy and heart failure

doi: 10.1186/s12929-025-01162-6

Figure Lengend Snippet: Graphical abstract. The gain-of-function of PRMT5 accelerates pressure overload-induced cardiomyocyte hypertrophy and heart failure. PRMT5 methylates p300 at R200 and regulates p300 HAT activity, which is essential for histone acetylation during the development of cardiomyocyte hypertrophy

Article Snippet: For Western blotting analysis, the primary antibodies used in this study were an anti-DDDDK-tag mAb (Cat#M185-3L, MBL Life Science), anti-HA-tag mAb (Cat#M132-3, MBL Life Science), anti-Myc-tag mAb (Cat#M192-3, MBL Life Science), anti-PRMT5 antibody (Cat#07-405, Merck, Tokyo, Japan), Symmetric Di-Methyl Arginine Motif Rabbit mAb (#13222, Cell Signaling Technology, Tokyo, Japan), anti-β-actin mouse monoclonal clone AC-15 IgG (Cat#A1978, Sigma-Aldrich), anti-GAPDH rabbit polyclonal antibody (10494-1-AP, Proteintech), anti-histone-H3 polyclonal antibody (17168-1-AP, Proteintech), acetyl-Histone H3 (Lys9) rabbit mAb (#9649, Cell Signaling Technology), rabbit polyclonal anti-acetyl-H3 (K14) antibody (#7627, Cell Signaling Technology), rabbit anti-dimethyl-histone H3 (Arg2) antibody (Cat#07-585, Merck), rabbit polyclonal anti-H4R3me2s antibody (Cat#AB_2793544, Active motif, Tokyo, Japan), and anti-Histone H3 (acetyl K122) antibody (ab33309, Abcam, Cambridge, UK).

Techniques: Activity Assay